ID: 985130004

View in Genome Browser
Species Human (GRCh38)
Location 4:186729451-186729473
Sequence CCATTAGAACATTAGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130000_985130004 6 Left 985130000 4:186729422-186729444 CCGGAATCAGCTTGTACTCTCAG No data
Right 985130004 4:186729451-186729473 CCATTAGAACATTAGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130004 Original CRISPR CCATTAGAACATTAGACACC TGG Intergenic
No off target data available for this crispr