ID: 985130581

View in Genome Browser
Species Human (GRCh38)
Location 4:186734798-186734820
Sequence AAGGCTATTATGGAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130581_985130591 26 Left 985130581 4:186734798-186734820 CCCACTCCCTCCATAATAGCCTT No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130581_985130587 -7 Left 985130581 4:186734798-186734820 CCCACTCCCTCCATAATAGCCTT No data
Right 985130587 4:186734814-186734836 TAGCCTTAATCTGTTCATGAGGG No data
985130581_985130586 -8 Left 985130581 4:186734798-186734820 CCCACTCCCTCCATAATAGCCTT No data
Right 985130586 4:186734813-186734835 ATAGCCTTAATCTGTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130581 Original CRISPR AAGGCTATTATGGAGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr