ID: 985130583

View in Genome Browser
Species Human (GRCh38)
Location 4:186734804-186734826
Sequence CAGATTAAGGCTATTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130583_985130591 20 Left 985130583 4:186734804-186734826 CCCTCCATAATAGCCTTAATCTG No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130583 Original CRISPR CAGATTAAGGCTATTATGGA GGG (reversed) Intergenic
No off target data available for this crispr