ID: 985130585

View in Genome Browser
Species Human (GRCh38)
Location 4:186734808-186734830
Sequence TGAACAGATTAAGGCTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130585_985130591 16 Left 985130585 4:186734808-186734830 CCATAATAGCCTTAATCTGTTCA No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130585 Original CRISPR TGAACAGATTAAGGCTATTA TGG (reversed) Intergenic
No off target data available for this crispr