ID: 985130588

View in Genome Browser
Species Human (GRCh38)
Location 4:186734817-186734839
Sequence TCACCCTCATGAACAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130588_985130597 25 Left 985130588 4:186734817-186734839 CCTTAATCTGTTCATGAGGGTGA No data
Right 985130597 4:186734865-186734887 CTAGGCCCCACCTCCCAACACGG No data
985130588_985130591 7 Left 985130588 4:186734817-186734839 CCTTAATCTGTTCATGAGGGTGA No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130588 Original CRISPR TCACCCTCATGAACAGATTA AGG (reversed) Intergenic
No off target data available for this crispr