ID: 985130591

View in Genome Browser
Species Human (GRCh38)
Location 4:186734847-186734869
Sequence ATGCCCAAATACCTCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985130582_985130591 25 Left 985130582 4:186734799-186734821 CCACTCCCTCCATAATAGCCTTA No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130584_985130591 19 Left 985130584 4:186734805-186734827 CCTCCATAATAGCCTTAATCTGT No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130583_985130591 20 Left 985130583 4:186734804-186734826 CCCTCCATAATAGCCTTAATCTG No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130581_985130591 26 Left 985130581 4:186734798-186734820 CCCACTCCCTCCATAATAGCCTT No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130588_985130591 7 Left 985130588 4:186734817-186734839 CCTTAATCTGTTCATGAGGGTGA No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data
985130585_985130591 16 Left 985130585 4:186734808-186734830 CCATAATAGCCTTAATCTGTTCA No data
Right 985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985130591 Original CRISPR ATGCCCAAATACCTCTCCCT AGG Intergenic
No off target data available for this crispr