ID: 985131172

View in Genome Browser
Species Human (GRCh38)
Location 4:186740234-186740256
Sequence GAATATAGGCAGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985131172_985131175 -9 Left 985131172 4:186740234-186740256 CCATCCACTCTCTGCCTATATTC No data
Right 985131175 4:186740248-186740270 CCTATATTCCTTGTAAACAAAGG No data
985131172_985131177 21 Left 985131172 4:186740234-186740256 CCATCCACTCTCTGCCTATATTC No data
Right 985131177 4:186740278-186740300 AAAGCAGCAGCAGTTTTCAAAGG No data
985131172_985131178 24 Left 985131172 4:186740234-186740256 CCATCCACTCTCTGCCTATATTC No data
Right 985131178 4:186740281-186740303 GCAGCAGCAGTTTTCAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985131172 Original CRISPR GAATATAGGCAGAGAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr