ID: 985131752

View in Genome Browser
Species Human (GRCh38)
Location 4:186745538-186745560
Sequence CAGGGCAGTGCAGTGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985131739_985131752 26 Left 985131739 4:186745489-186745511 CCCAGAGCCAGCAAATGAAATAT No data
Right 985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG No data
985131744_985131752 19 Left 985131744 4:186745496-186745518 CCAGCAAATGAAATATGGGGTTG No data
Right 985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG No data
985131740_985131752 25 Left 985131740 4:186745490-186745512 CCAGAGCCAGCAAATGAAATATG No data
Right 985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985131752 Original CRISPR CAGGGCAGTGCAGTGATGGC AGG Intergenic
No off target data available for this crispr