ID: 985132247

View in Genome Browser
Species Human (GRCh38)
Location 4:186750441-186750463
Sequence GTTTTCCTGAAAGAAAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985132247_985132250 -8 Left 985132247 4:186750441-186750463 CCTGTACTTTCTTTCAGGAAAAC No data
Right 985132250 4:186750456-186750478 AGGAAAACCAGATAGTGGATGGG No data
985132247_985132249 -9 Left 985132247 4:186750441-186750463 CCTGTACTTTCTTTCAGGAAAAC No data
Right 985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985132247 Original CRISPR GTTTTCCTGAAAGAAAGTAC AGG (reversed) Intergenic
No off target data available for this crispr