ID: 985132250

View in Genome Browser
Species Human (GRCh38)
Location 4:186750456-186750478
Sequence AGGAAAACCAGATAGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985132246_985132250 -7 Left 985132246 4:186750440-186750462 CCCTGTACTTTCTTTCAGGAAAA No data
Right 985132250 4:186750456-186750478 AGGAAAACCAGATAGTGGATGGG No data
985132247_985132250 -8 Left 985132247 4:186750441-186750463 CCTGTACTTTCTTTCAGGAAAAC No data
Right 985132250 4:186750456-186750478 AGGAAAACCAGATAGTGGATGGG No data
985132244_985132250 -3 Left 985132244 4:186750436-186750458 CCTTCCCTGTACTTTCTTTCAGG No data
Right 985132250 4:186750456-186750478 AGGAAAACCAGATAGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985132250 Original CRISPR AGGAAAACCAGATAGTGGAT GGG Intergenic
No off target data available for this crispr