ID: 985136694

View in Genome Browser
Species Human (GRCh38)
Location 4:186793278-186793300
Sequence TGAAATACACATTCATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985136694_985136695 14 Left 985136694 4:186793278-186793300 CCACAGAATGAATGTGTATTTCA No data
Right 985136695 4:186793315-186793337 TTACCGAGCTAAGCTTAAGTAGG No data
985136694_985136697 21 Left 985136694 4:186793278-186793300 CCACAGAATGAATGTGTATTTCA No data
Right 985136697 4:186793322-186793344 GCTAAGCTTAAGTAGGTGCCTGG No data
985136694_985136698 27 Left 985136694 4:186793278-186793300 CCACAGAATGAATGTGTATTTCA No data
Right 985136698 4:186793328-186793350 CTTAAGTAGGTGCCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985136694 Original CRISPR TGAAATACACATTCATTCTG TGG (reversed) Intergenic
No off target data available for this crispr