ID: 985136695

View in Genome Browser
Species Human (GRCh38)
Location 4:186793315-186793337
Sequence TTACCGAGCTAAGCTTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985136693_985136695 29 Left 985136693 4:186793263-186793285 CCTGCTGGTCTCTTACCACAGAA No data
Right 985136695 4:186793315-186793337 TTACCGAGCTAAGCTTAAGTAGG No data
985136694_985136695 14 Left 985136694 4:186793278-186793300 CCACAGAATGAATGTGTATTTCA No data
Right 985136695 4:186793315-186793337 TTACCGAGCTAAGCTTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985136695 Original CRISPR TTACCGAGCTAAGCTTAAGT AGG Intergenic
No off target data available for this crispr