ID: 985136698

View in Genome Browser
Species Human (GRCh38)
Location 4:186793328-186793350
Sequence CTTAAGTAGGTGCCTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985136694_985136698 27 Left 985136694 4:186793278-186793300 CCACAGAATGAATGTGTATTTCA No data
Right 985136698 4:186793328-186793350 CTTAAGTAGGTGCCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985136698 Original CRISPR CTTAAGTAGGTGCCTGGCAT TGG Intergenic
No off target data available for this crispr