ID: 985139966

View in Genome Browser
Species Human (GRCh38)
Location 4:186829789-186829811
Sequence ACACCTCGATTTTGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985139963_985139966 11 Left 985139963 4:186829755-186829777 CCCTGGAGCTTCACATAAGAGCT No data
Right 985139966 4:186829789-186829811 ACACCTCGATTTTGGCCTTGTGG No data
985139964_985139966 10 Left 985139964 4:186829756-186829778 CCTGGAGCTTCACATAAGAGCTC No data
Right 985139966 4:186829789-186829811 ACACCTCGATTTTGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985139966 Original CRISPR ACACCTCGATTTTGGCCTTG TGG Intergenic