ID: 985139989

View in Genome Browser
Species Human (GRCh38)
Location 4:186830112-186830134
Sequence TAGGGAAATAAAGCAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985139989_985139994 8 Left 985139989 4:186830112-186830134 CCAGCTACTGCTTTATTTCCCTA No data
Right 985139994 4:186830143-186830165 GAACAGTTAAAACTCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985139989 Original CRISPR TAGGGAAATAAAGCAGTAGC TGG (reversed) Intergenic
No off target data available for this crispr