ID: 985140699

View in Genome Browser
Species Human (GRCh38)
Location 4:186837653-186837675
Sequence GAAAATGCACATATACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985140699_985140701 21 Left 985140699 4:186837653-186837675 CCATGGTGTATATGTGCATTTTC No data
Right 985140701 4:186837697-186837719 GAGGCAGCCTAACTACTGAAAGG No data
985140699_985140700 2 Left 985140699 4:186837653-186837675 CCATGGTGTATATGTGCATTTTC No data
Right 985140700 4:186837678-186837700 GCTGTAAAGATGTCATACAGAGG No data
985140699_985140702 24 Left 985140699 4:186837653-186837675 CCATGGTGTATATGTGCATTTTC No data
Right 985140702 4:186837700-186837722 GCAGCCTAACTACTGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985140699 Original CRISPR GAAAATGCACATATACACCA TGG (reversed) Intergenic
No off target data available for this crispr