ID: 985142464

View in Genome Browser
Species Human (GRCh38)
Location 4:186856267-186856289
Sequence CATTTGGCCAAGATTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985142457_985142464 14 Left 985142457 4:186856230-186856252 CCCAAATCAAGTAACCCTTTACC No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data
985142461_985142464 -7 Left 985142461 4:186856251-186856273 CCTAGATGAAACTCTCCATTTGG No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data
985142458_985142464 13 Left 985142458 4:186856231-186856253 CCAAATCAAGTAACCCTTTACCT No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data
985142459_985142464 0 Left 985142459 4:186856244-186856266 CCCTTTACCTAGATGAAACTCTC No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data
985142460_985142464 -1 Left 985142460 4:186856245-186856267 CCTTTACCTAGATGAAACTCTCC No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data
985142456_985142464 19 Left 985142456 4:186856225-186856247 CCTTACCCAAATCAAGTAACCCT No data
Right 985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985142464 Original CRISPR CATTTGGCCAAGATTGATAT AGG Intergenic
No off target data available for this crispr