ID: 985142626

View in Genome Browser
Species Human (GRCh38)
Location 4:186858070-186858092
Sequence TGTGCTGTCAGACAAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985142626_985142631 25 Left 985142626 4:186858070-186858092 CCTTGTTTTTGTCTGACAGCACA No data
Right 985142631 4:186858118-186858140 CCTCCTAGAAACAACCTAAAGGG No data
985142626_985142629 24 Left 985142626 4:186858070-186858092 CCTTGTTTTTGTCTGACAGCACA No data
Right 985142629 4:186858117-186858139 GCCTCCTAGAAACAACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985142626 Original CRISPR TGTGCTGTCAGACAAAAACA AGG (reversed) Intergenic
No off target data available for this crispr