ID: 985145438

View in Genome Browser
Species Human (GRCh38)
Location 4:186890287-186890309
Sequence CCGGTGGGCCGGCACTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145438_985145448 21 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145438_985145449 22 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145438_985145452 27 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG No data
Right 985145452 4:186890337-186890359 TAGCTGCCTCCCCTCGGGCAGGG No data
985145438_985145451 26 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145438 Original CRISPR CCGGTGGGCCGGCACTGCTG GGG (reversed) Intergenic