ID: 985145440

View in Genome Browser
Species Human (GRCh38)
Location 4:186890288-186890310
Sequence GCCGGTGGGCCGGCACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1576
Summary {0: 121, 1: 490, 2: 425, 3: 286, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145440_985145451 25 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145440_985145453 30 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145440_985145452 26 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145452 4:186890337-186890359 TAGCTGCCTCCCCTCGGGCAGGG No data
985145440_985145448 20 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145440_985145449 21 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145440 Original CRISPR GCCGGTGGGCCGGCACTGCT GGG (reversed) Intergenic
900113260 1:1018498-1018520 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
900134099 1:1106938-1106960 GCAGGGGGGCTGGCAGTGCTGGG - Intronic
900399032 1:2465412-2465434 GCCCATGGGCCGGCACAGCTGGG - Intronic
900463682 1:2813447-2813469 GGAGGTGGGCCGGCAGTGCTGGG - Intergenic
901601463 1:10426546-10426568 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
901783356 1:11608931-11608953 CACGGTGGGCTGGCACTGCTGGG - Intergenic
902032604 1:13434030-13434052 ACCAGTGGGCCTGCACTGCTGGG + Intergenic
902100420 1:13983349-13983371 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
903595384 1:24490133-24490155 GTGGGTGGGTCGGCACTGCTGGG - Intergenic
905375642 1:37518425-37518447 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
905742903 1:40388026-40388048 GCCGGTGGGCCGGCACTGCTGGG - Intronic
905761139 1:40559067-40559089 GCTGGCGGGTCAGCACTGCTGGG + Intergenic
905908132 1:41633345-41633367 GCAGGTGGGCCCTCACTGCCCGG - Intronic
906044479 1:42817283-42817305 GGCGGTGGGCAGGCAGCGCTGGG - Intronic
906083207 1:43107698-43107720 CGCTGTGGGCCAGCACTGCTGGG + Intergenic
906876154 1:49541507-49541529 ACCGGCAGGCCGGCACTGCTGGG - Intronic
906877699 1:49556888-49556910 GCGGGTGGGCCTGCAGTGCTGGG + Intronic
907102228 1:51847564-51847586 GCCAGTGGGCTGGCACTGCTGGG + Intronic
907371140 1:54004413-54004435 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
907889505 1:58623604-58623626 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
908027739 1:59969851-59969873 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
908291350 1:62670063-62670085 ACCGGTGGGCCGGCACTGCTGGG - Intronic
908301109 1:62761687-62761709 GCGGGCAGGCCGGCAGTGCTGGG - Intergenic
908888600 1:68817885-68817907 GTCGGTGGGCCGGCACTGCTGGG - Intergenic
909318031 1:74248094-74248116 GCAGGTGGGCTGGCAGTGCTGGG + Intronic
909318532 1:74253528-74253550 GCCAGTGGGCCGGCACTGCTGGG + Intronic
909377062 1:74952234-74952256 TCCGGTGGGCCAGCACTGCTGGG + Intergenic
909592806 1:77370779-77370801 GCTGCTGGCCTGGCACTGCTTGG - Intronic
909904555 1:81178794-81178816 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
910371779 1:86523996-86524018 GCAGATGGGCAGGCAGTGCTGGG + Intergenic
910609744 1:89128228-89128250 GCCGGTGGGCTGGCACTGCTGGG + Intronic
911205934 1:95091540-95091562 GCCGGCGGGCTGGCACTGCTAGG - Intergenic
911259590 1:95669815-95669837 GCTGGCGGGCTGGCACTGCTGGG + Intergenic
911305222 1:96224525-96224547 GCCGTTGGGCCGGCACTGCTGGG + Intergenic
911807951 1:102234999-102235021 GCGGGCGGGCTGGCAGTGCTGGG + Intergenic
911839238 1:102660199-102660221 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
911950884 1:104172501-104172523 ATGGGTGGGCCGGCAGTGCTGGG - Intergenic
911954486 1:104217631-104217653 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
912058111 1:105631422-105631444 GCCGGTGGGCCGGCACTGCCGGG + Intergenic
912166167 1:107044942-107044964 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
912312868 1:108641056-108641078 GCCGGTGGGCTGGCACTGCTGGG + Intronic
912315940 1:108667649-108667671 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
912538742 1:110396520-110396542 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
912576313 1:110675182-110675204 CCCCGTGGGCCGGCTCTGCTGGG - Intergenic
912819362 1:112854700-112854722 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
913161054 1:116146742-116146764 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
913692100 1:121289291-121289313 GCCGATGGTCCGGCACTGCTGGG + Intronic
913987104 1:143575234-143575256 ACTGGTGGGCCAGCACTGCTGGG - Intergenic
914145456 1:144990823-144990845 GCCGATGGGCCGGCACTGCTGGG - Intronic
914203425 1:145506057-145506079 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
914438431 1:147680953-147680975 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
914482547 1:148079211-148079233 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
914928073 1:151906310-151906332 GCCAGTGGGCCGGCACTGCTGGG - Intronic
915104140 1:153521960-153521982 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
915260065 1:154670924-154670946 GCCAGCGGGCTGGCACTGCTGGG - Intergenic
915261236 1:154678211-154678233 GCCAGCGGGCTGGCACTGCTGGG - Intergenic
915666099 1:157446469-157446491 GGCTGTGGGCCGGCACTGCTGGG + Intergenic
915764482 1:158349176-158349198 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
915767149 1:158374341-158374363 CGCAGTGAGCCGGCACTGCTGGG + Intergenic
915865543 1:159494795-159494817 ACAGGTGGGCTGGCACTGCTGGG + Intergenic
916115046 1:161479177-161479199 GCAGGTGGGCCGGCAGTGCTGGG - Intergenic
916219877 1:162433326-162433348 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
916910101 1:169337264-169337286 GCCGGTGGGCTGGCACTGCTGGG + Intronic
916960292 1:169882284-169882306 ACCGGTGGGCTGGCACTGCTGGG - Intronic
917406345 1:174711570-174711592 GCGGGTGGGCCAGCAGTGCTGGG - Intronic
917445396 1:175102487-175102509 GCCGGTGGGCTGGCACTGCTGGG + Intronic
917446351 1:175108644-175108666 GCCGGTGGGCTGGCACTGCTGGG + Intronic
917578534 1:176349453-176349475 GCCTGTTGGCTGGCACTGCTGGG + Intergenic
917860526 1:179139020-179139042 ACCGGTGGGCTGGCACTGCTGGG - Intronic
917932986 1:179837117-179837139 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
918002251 1:180508775-180508797 GCCGGTGGGCCGGTACTGCTGGG - Intergenic
918059016 1:181046003-181046025 GCTGGTGGGCTGGCACTTCTGGG - Intronic
918542690 1:185649114-185649136 GCAGGCGGGCTGGCAGTGCTGGG + Intergenic
918659751 1:187074003-187074025 GCCGGTGGGCTGGCACTGCTTGG + Intergenic
918708951 1:187703793-187703815 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
918720844 1:187850375-187850397 GCAGGTGGGCTGGCACTGCTGGG - Intergenic
918732291 1:188013489-188013511 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
918789984 1:188813254-188813276 GCCCGTGGGCTGGCACTGCTAGG - Intergenic
918792027 1:188841362-188841384 GCCGGTGAGCTGGCACTGCTGGG + Intergenic
918853200 1:189718485-189718507 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
919091914 1:192987084-192987106 ACCAGTGGGCTGGCACTGCTGGG - Intergenic
919167941 1:193919099-193919121 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
919174483 1:194002015-194002037 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
919237052 1:194859247-194859269 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
919386882 1:196933885-196933907 GCTGGCCTGCCGGCACTGCTGGG - Intronic
919419763 1:197355582-197355604 ACTGGTGTGCTGGCACTGCTGGG + Intronic
920479423 1:206307639-206307661 GCCGATGGGCCGGCACTGCTGGG + Intronic
920670164 1:207997935-207997957 GACGGTGGAGCTGCACTGCTGGG - Intergenic
920731360 1:208488624-208488646 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
920756686 1:208739851-208739873 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
920878446 1:209858838-209858860 GCCAGCGGGCCGGCACTGCTGGG + Intergenic
920882023 1:209889133-209889155 GTCGGTGGGCCGGCACTGCTGGG + Intergenic
920883143 1:209898987-209899009 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
921094415 1:211874479-211874501 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
921396374 1:214673333-214673355 GCGGGTGGGCTGGCACTGCTGGG + Intergenic
921801818 1:219410825-219410847 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
921897108 1:220412605-220412627 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
921903824 1:220475856-220475878 GGCGGTGGGCCGGCACTGCTGGG + Intergenic
921983662 1:221285845-221285867 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
922056835 1:222049919-222049941 ACGGGTGGGCTGGCACTGCTGGG - Intergenic
922423218 1:225472880-225472902 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
922485437 1:225969939-225969961 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
922541901 1:226426479-226426501 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
922855804 1:228773878-228773900 GTCAGCGGGCTGGCACTGCTGGG - Intergenic
922985890 1:229865629-229865651 GCCGGCAGGCTGGCACTGCTGGG - Intergenic
923157222 1:231289662-231289684 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
923324800 1:232871631-232871653 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
923353187 1:233129280-233129302 ACCGGTGGGCTGGCACTGCTGGG - Intronic
923573827 1:235140467-235140489 GCCAGTGGGTTGGCACTGCTGGG - Intronic
923810514 1:237309813-237309835 ACCGGTGGGCTGGCACTGCTGGG + Intronic
923930066 1:238684817-238684839 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
924117531 1:240762662-240762684 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
924219226 1:241855766-241855788 GCCGGTGGGCCGGCACTGCTGGG + Intronic
924305956 1:242689601-242689623 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
924313773 1:242774555-242774577 GCGGGCGGGCGGGCAGTGCTGGG + Intergenic
924655622 1:245972711-245972733 GACTGTGGGCTGGCCCTGCTGGG + Intronic
1063148942 10:3320007-3320029 GCCAGTGGGCTAGCACTGCTGGG + Intergenic
1063300383 10:4845102-4845124 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1063318720 10:5032705-5032727 GCGGGTGGGCTGGCACTGCTGGG + Intronic
1063769706 10:9183523-9183545 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1064197801 10:13259779-13259801 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1064461028 10:15535109-15535131 ACCGGTGGGCCGGCACTGCTGGG - Intronic
1064790349 10:18951466-18951488 GCGGGTGGGCTGGCACTGCTGGG + Intergenic
1065284786 10:24176911-24176933 ACAGGTGGGCTGGCAGTGCTGGG + Intronic
1065441347 10:25756172-25756194 ACCAGTGGGCCGGCACTGCTGGG - Intergenic
1065554915 10:26905719-26905741 GCCGTCGGGCTGGCACTGCTGGG - Intergenic
1065743267 10:28815860-28815882 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1065802613 10:29366352-29366374 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1065995515 10:31055996-31056018 GCCTGTGTGGCGGCACTGCTGGG - Intergenic
1066057454 10:31695292-31695314 GCTGGTGGGCAGGAACTGCCGGG + Intergenic
1066186315 10:33013465-33013487 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1066190274 10:33049399-33049421 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1066234056 10:33468207-33468229 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1066235454 10:33480655-33480677 ACCGGTGGGCCGGCACTGCTGGG + Intergenic
1066544235 10:36482185-36482207 GCTGGTGGGCTGGCAGTGCTGGG + Intergenic
1066567389 10:36734806-36734828 GCCGGTGGGCCTGCACTGTTGGG + Intergenic
1066575487 10:36820105-36820127 GCTGGTGGGCTAGCACTGCTGGG - Intergenic
1066590555 10:36989479-36989501 GCGCGTGGGCTGGCAGTGCTGGG + Intergenic
1066615052 10:37285353-37285375 ACCAGTGGTTCGGCACTGCTAGG + Intronic
1066997563 10:42578030-42578052 GCCGGTGGGCCTGCCCTGAGGGG + Intronic
1067363204 10:45600915-45600937 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1068374034 10:56155296-56155318 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1068455548 10:57250012-57250034 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1068863181 10:61867818-61867840 GTCGGTGGGCTGGCACTGCTGGG - Intergenic
1068902126 10:62280551-62280573 GCCGGTGGGCTGCCACTGCTGGG - Intergenic
1068978150 10:63033762-63033784 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1069090801 10:64196961-64196983 GCCGGCGGGCCGGCACTGCTGGG + Intergenic
1069186510 10:65429595-65429617 GCCAGTGGGCCGGCACTGCTTGG + Intergenic
1069280829 10:66651650-66651672 GCCCGCCGGCCGGCACTGCTGGG + Intronic
1069766154 10:70861816-70861838 GCCGGTAGGCCGGCACTACTGGG - Intronic
1069988688 10:72300783-72300805 CGCAGTGGGCCGGCACTGCTGGG - Intergenic
1069989180 10:72304000-72304022 GCCAGTGGGCACGCAGTGCTGGG - Intergenic
1069992984 10:72326127-72326149 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1070247205 10:74743818-74743840 GCCGGTGGGACGGCACAGCCTGG - Intergenic
1070942553 10:80359677-80359699 GCTGGCAGGCCGGCACTGCTGGG + Intronic
1070973393 10:80586049-80586071 GCCGCTGGGCCGGCACTGCTGGG - Intronic
1071003769 10:80859413-80859435 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1071037470 10:81265101-81265123 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1071041081 10:81309262-81309284 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1071085346 10:81862876-81862898 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1071332194 10:84571371-84571393 CCCTGTTGGCCAGCACTGCTGGG - Intergenic
1071388017 10:85141573-85141595 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1071611000 10:87031167-87031189 GTGGGCGGGCCGGCAGTGCTGGG + Intergenic
1071963771 10:90832364-90832386 GCAGGTGGGCCAGCACTGCTGGG + Intronic
1072990225 10:100185826-100185848 GCCAGTGGGCCGCCCCTGCTCGG + Exonic
1073268078 10:102240523-102240545 GCAGCTGGGCAGGCGCTGCTGGG + Intronic
1073285074 10:102382634-102382656 GACCGTGGGCAGGCACTGCAGGG - Exonic
1073532527 10:104245346-104245368 GCCAGTGGGCTGGCACTGCTGGG - Intronic
1074098143 10:110331631-110331653 GCTGCTGGGCTGGCACTGCTGGG - Intergenic
1074317160 10:112370484-112370506 ACTGGTGGGCCGGCACTGCTGGG - Intergenic
1074317164 10:112370498-112370520 ACTGGTGGGCCGGCACTGGTGGG - Intergenic
1074996331 10:118760334-118760356 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1074999244 10:118783076-118783098 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1075255634 10:120923998-120924020 GCCGATGGGCTGGCACTGCTGGG - Intergenic
1075269367 10:121035526-121035548 GCCGATGGGCTGGCACTGCTGGG + Intergenic
1075376014 10:121978576-121978598 GCTGGTGGGCTGGCACTGTTGGG + Intergenic
1075504993 10:123013691-123013713 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1075537515 10:123283540-123283562 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1076261647 10:129071539-129071561 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1076383752 10:130042807-130042829 GGAGGTGGGCCGTCACGGCTTGG + Intergenic
1076773621 10:132680826-132680848 GCCGGTGGGTGGGCACTGCTGGG - Intronic
1076796526 10:132801132-132801154 GCCGGTGGGTGGGCACTGCTGGG + Intergenic
1077629003 11:3798007-3798029 CCCGGTCCGCCGGCGCTGCTGGG + Intronic
1077805775 11:5590052-5590074 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1078251890 11:9623222-9623244 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1078301189 11:10133491-10133513 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1078566428 11:12418311-12418333 GCCTGTGGGCGGGGCCTGCTGGG - Intronic
1078743682 11:14091514-14091536 ACCGGTGGGCCGGCACTGCTGGG + Intronic
1078795832 11:14591237-14591259 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1079726210 11:23883618-23883640 GATGGTGGGCTGGCACTGCTGGG + Intergenic
1079730559 11:23934936-23934958 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1079731745 11:23942465-23942487 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1079767766 11:24416187-24416209 ACCGGCGGGTTGGCACTGCTGGG + Intergenic
1080106010 11:28512518-28512540 GCCGGTGAGCCGGCACTGCTGGG + Intergenic
1080107492 11:28525987-28526009 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1080195185 11:29600333-29600355 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1080204432 11:29712820-29712842 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1080557682 11:33431930-33431952 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1080621457 11:33990273-33990295 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1081046398 11:38278786-38278808 GAGGGTGGGCCGGCAGTGCTAGG + Intergenic
1081115320 11:39192738-39192760 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1081125072 11:39312002-39312024 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1081126927 11:39333256-39333278 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1081136140 11:39442249-39442271 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1081329701 11:41788413-41788435 ACCAGTGGGCCGGCACTGCTGGG + Intergenic
1081374697 11:42344520-42344542 GCAGGTGGGCCAGCAGTGCTGGG + Intergenic
1081420907 11:42874091-42874113 ACAGGTGGGCTGGCACTACTGGG - Intergenic
1081422079 11:42881556-42881578 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1081428398 11:42950059-42950081 CCCAGTGGTCTGGCACTGCTGGG - Intergenic
1082698750 11:56402106-56402128 GCTAGTGGGCTGGCACTGCTTGG + Intergenic
1082924635 11:58532122-58532144 ACAGGTGGGCCAGCAGTGCTAGG - Intronic
1083546121 11:63550379-63550401 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1083897975 11:65629755-65629777 TCGGGTGGGCAGGCACAGCTCGG + Intronic
1084107422 11:66988968-66988990 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1084210473 11:67619210-67619232 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1084648241 11:70473331-70473353 GTCGGGGGGCCGGCTCTGCAGGG + Intronic
1084787061 11:71448565-71448587 GCCGGTGGGGCGGCAGGGCGGGG - Intronic
1085245609 11:75098380-75098402 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1085375897 11:76060738-76060760 GCCGGTGTGCTGGCACTGCTGGG - Intronic
1085447234 11:76609216-76609238 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1085687701 11:78639024-78639046 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1085863142 11:80257736-80257758 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1085886950 11:80532931-80532953 GCGGGTGGGCAAGCAGTGCTGGG + Intergenic
1085941142 11:81207790-81207812 GCCTGTGTGCCAGTACTGCTGGG - Intergenic
1086001078 11:81986862-81986884 GTGGGTGGGCCAGCAGTGCTGGG + Intergenic
1086043046 11:82501332-82501354 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1086087577 11:82970846-82970868 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1086210111 11:84308723-84308745 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1086397738 11:86433708-86433730 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1086552510 11:88069224-88069246 ACGGGTGGGCTGGCAGTGCTGGG - Intergenic
1086808026 11:91268930-91268952 GTCGGGGGGCTGGCACTGCTGGG - Intergenic
1087407305 11:97745805-97745827 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1087486382 11:98763597-98763619 GCAGGTGGTCTGGCACTGCTGGG + Intergenic
1087683797 11:101241436-101241458 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1087966555 11:104422616-104422638 ACTGGTGGGCCAGCACTGCTGGG + Intergenic
1087977258 11:104565134-104565156 GCCGGCGGGCCAGCAGTGCTGGG + Intergenic
1089062109 11:115634080-115634102 GCCTGTGGGCCGGCACTGCTGGG + Intergenic
1089244725 11:117110639-117110661 GCCGGCGGGCCGGCACTGCTGGG + Intergenic
1089373561 11:117978674-117978696 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1089466393 11:118689161-118689183 GCCAGTGGGCCTGCACTGCTGGG + Intergenic
1089666876 11:120026072-120026094 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1089800250 11:121021833-121021855 GCCGGTGGGCTGGCACTGCCGGG - Intergenic
1090229234 11:125089670-125089692 GCAGGTGGGCCGGCACTGCTGGG - Intronic
1090307673 11:125704889-125704911 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1090558139 11:127898754-127898776 GTGGGTGGGCCGGCAGTGCTGGG + Intergenic
1091233441 11:134003049-134003071 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1092135213 12:6142370-6142392 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1092142093 12:6191057-6191079 GCGGGTGGGCCAGCACTGCTGGG + Intergenic
1092220299 12:6708456-6708478 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1092221410 12:6716210-6716232 GCCGGTGGGCTAGCACTGCTGGG - Intergenic
1092272935 12:7037594-7037616 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1092336690 12:7640013-7640035 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1092350508 12:7752260-7752282 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1092364065 12:7862359-7862381 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1092366565 12:7881456-7881478 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1092471780 12:8787440-8787462 GCCAGAGGGCTGGCACTGCTGGG - Intergenic
1092472972 12:8794897-8794919 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1092572409 12:9739763-9739785 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1092583792 12:9876219-9876241 GGGGGTGGGCCGGCACTGCTGGG + Intergenic
1092617141 12:10225815-10225837 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1093034507 12:14320267-14320289 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1093189412 12:16057548-16057570 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1093266282 12:17007797-17007819 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1093381578 12:18500319-18500341 GCTGGTGGGCCGGCACTGCTGGG - Intronic
1093443764 12:19230544-19230566 GCGGGTAGGCTGGCAGTGCTGGG + Intronic
1093527077 12:20115416-20115438 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1093580156 12:20777598-20777620 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1093581013 12:20783967-20783989 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1093583267 12:20807627-20807649 GCTGGCCGGCCGGCACTGCTGGG + Intergenic
1093652562 12:21661703-21661725 GCCAGTGGGCCGGCGCTGCTGGG - Intronic
1093653929 12:21674239-21674261 GCCAGTGGGCCGGCACTGCTGGG + Intronic
1093715533 12:22377080-22377102 GCCGGTGAGCCGGCACTGCTGGG - Intronic
1093793726 12:23286099-23286121 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1093921678 12:24866250-24866272 GCCGGTGGGCCAGCACTGCTGGG - Intronic
1093970227 12:25369540-25369562 GCCGGTAGGCTGGCACTGCTGGG - Intergenic
1093972971 12:25391602-25391624 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1094108795 12:26839346-26839368 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1094327572 12:29256816-29256838 GCCGTTGGGCTGGCACTGCTGGG - Intronic
1094338597 12:29386427-29386449 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1094409845 12:30157033-30157055 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1094448734 12:30561807-30561829 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1094589291 12:31805976-31805998 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1094661295 12:32472465-32472487 ACCGGTGGGCCAGCACTGCTGGG - Intronic
1094666497 12:32525847-32525869 ACCGGTGGGCCAGCAGTGCTGGG - Intronic
1094718186 12:33034118-33034140 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1094833205 12:34309865-34309887 GCGGGCGGGCCGGCACTGCTGGG - Intergenic
1095123104 12:38442122-38442144 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1095444946 12:42273889-42273911 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1095587420 12:43864067-43864089 GCTGGTGGGCCAGCACTGCTGGG - Intronic
1095776713 12:46018190-46018212 CCGGGTGAGCTGGCACTGCTCGG - Intergenic
1095901553 12:47333558-47333580 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1097017914 12:56000330-56000352 GCTGGTGGGCCGGCACTGCTGGG + Intronic
1097128928 12:56796026-56796048 GCCGATGGGCCGGCACTGCTGGG + Intergenic
1097253691 12:57655940-57655962 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
1098168207 12:67719419-67719441 GCCGGTGGGCTAGCACTGCTGGG + Intergenic
1098498747 12:71166395-71166417 GCCGGTTTGCCCGCACTGCTGGG + Intronic
1098515998 12:71377017-71377039 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1098588683 12:72185219-72185241 CCCGGTGGGCCGGCACTGCTGGG - Intronic
1098759253 12:74403120-74403142 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1099191396 12:79565125-79565147 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1099204366 12:79711108-79711130 GTCGGTGGGCCGGCACTGCTGGG - Intergenic
1099228146 12:79993411-79993433 GCCGGTGGGCCAGTACTGCTGGG + Intergenic
1099413704 12:82361604-82361626 GCTGGTGGGCCGGCACTGCTGGG + Intronic
1099523928 12:83696473-83696495 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1099559610 12:84155308-84155330 ACAGGTGGGCTGGCACTGCTGGG + Intergenic
1099716219 12:86296589-86296611 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1099790722 12:87330389-87330411 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1100142348 12:91634114-91634136 GCCGGTAGGCTGGCACTGCTGGG - Intergenic
1100211873 12:92406705-92406727 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1100521464 12:95379758-95379780 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1100584705 12:95969308-95969330 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1101009001 12:100430475-100430497 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1101021635 12:100559555-100559577 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1101461952 12:104905699-104905721 GCCGGTGGGCCAGCATTGCTGGG + Intronic
1101603852 12:106233184-106233206 GTGGGTGGGCCAGCACTGCTGGG - Intergenic
1102309766 12:111835827-111835849 ACTGGTGGGCCGGCACTGCTGGG - Intergenic
1102898803 12:116620165-116620187 GCCTTTGAGCCTGCACTGCTGGG - Intergenic
1103239099 12:119398227-119398249 GCGGGCAGGCCGGCAGTGCTGGG + Intronic
1103439218 12:120950528-120950550 GCCCGTGGCCCGGCACTGCTGGG + Intergenic
1103668558 12:122592198-122592220 GCCCGTGGGCTGGTACTGCTGGG - Intronic
1103783385 12:123414300-123414322 GCCGGTGGGCTGGCACTGCTGGG + Exonic
1103853302 12:123947134-123947156 GCTGGTGGGCTGGCACTGCTAGG - Intronic
1104344502 12:127983556-127983578 GCCAGTGGGCCAGTACTGCTAGG - Intergenic
1104582649 12:130022228-130022250 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1104614506 12:130256841-130256863 GCTGGTGGGATGGCACTGCTGGG + Intergenic
1104749248 12:131227985-131228007 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1105037763 12:132938927-132938949 GCCGGTGGGCCAGCACTGCTGGG - Intronic
1105274335 13:18905912-18905934 GCCGGTGGGGGGGCACTATTGGG + Intergenic
1105425657 13:20292590-20292612 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1105477384 13:20740116-20740138 GCAGGTGGGCCGGTAGTGCTGGG + Intronic
1105593892 13:21818117-21818139 GCCGGCCGGCAGGCAGTGCTGGG - Intergenic
1105605146 13:21920852-21920874 GCCGCTGGGCCGGCACTGCTGGG + Intergenic
1105722184 13:23127745-23127767 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1105871133 13:24506993-24507015 GCTGGTGGGCCGGCACTGCTGGG + Intronic
1105876674 13:24560892-24560914 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1106221315 13:27748501-27748523 GCCCGTGGGCTGGCACTGCTGGG + Intergenic
1106617056 13:31339853-31339875 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1106643421 13:31609014-31609036 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1106810958 13:33358154-33358176 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1107332266 13:39313885-39313907 GCCGGTGGGCAGGTACTGACAGG - Intergenic
1107590454 13:41898765-41898787 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1107836124 13:44413748-44413770 GTCGGTGGGCTGGCACTGCTGGG - Intergenic
1108099168 13:46936242-46936264 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1108435354 13:50396768-50396790 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1108469449 13:50753494-50753516 ACTGGTGGGCCGGCTCTGCTGGG + Intronic
1108643966 13:52408263-52408285 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1108751523 13:53452580-53452602 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1108851605 13:54737463-54737485 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1108858949 13:54829687-54829709 ACCAGTGGGCTGGCACTGCTGGG + Intergenic
1109111006 13:58318723-58318745 GCCAGTGGGCCAGCATTGCTGGG + Intergenic
1109141058 13:58714256-58714278 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1109152112 13:58859046-58859068 GCTGGCGGGCCGGCACTGCTGGG + Intergenic
1109159863 13:58958369-58958391 GCCGATGGGCTGGCACTGTTGGG + Intergenic
1109201878 13:59440083-59440105 GCCTGTGGGCCGGCACTGCTGGG - Intergenic
1109364646 13:61339338-61339360 GCCTGTGGGCCGGAATTGCTGGG - Intergenic
1109441377 13:62379401-62379423 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1109446603 13:62448086-62448108 GCGGGTGGGCTGGCACTGCTGGG + Intergenic
1109506162 13:63305908-63305930 GCCGGTGGGCCAACACTGCTGGG - Intergenic
1109699707 13:66009543-66009565 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1109745829 13:66622122-66622144 GCCCGTGGGCCAGCACTGCTGGG - Intronic
1109854287 13:68107904-68107926 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1110368877 13:74718565-74718587 CCCTGTGGGCTGGCACTGCTGGG - Intergenic
1110417494 13:75268622-75268644 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1110440202 13:75518726-75518748 GCGGGCGGGCCAGCAGTGCTGGG - Intergenic
1110751389 13:79119822-79119844 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1110792387 13:79600345-79600367 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1110862144 13:80355720-80355742 GCTGGTGGGCTGGCACTGCGGGG - Intergenic
1110874359 13:80490749-80490771 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1110940285 13:81340958-81340980 GCCGGTGGGCTGGCACTGCTTGG + Intergenic
1110999836 13:82165137-82165159 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1111006655 13:82258133-82258155 GTTCGTGGGCCAGCACTGCTGGG - Intergenic
1111220915 13:85205086-85205108 GTGGGCGGGCCGGCAGTGCTGGG - Intergenic
1111333576 13:86792430-86792452 TACGGCGGGCCGGCAGTGCTGGG - Intergenic
1111441914 13:88291993-88292015 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
1111591031 13:90348772-90348794 GCGGGTGGGCTGGCACTGCTGGG - Intergenic
1111602732 13:90494953-90494975 GCCGGCGGACTGGCACTGCTGGG - Intergenic
1111748336 13:92296839-92296861 GCCAGTGGGCCGGCACTGCTGGG - Intronic
1111841404 13:93454972-93454994 GTCGGTGGGTTGGCACTGCTGGG + Intronic
1112226511 13:97545450-97545472 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1112518657 13:100077689-100077711 ACCGGTGGGCCAGCACTGCTGGG - Intergenic
1112533164 13:100224236-100224258 GCTGGTGGGCTGGCACTGCTGGG + Intronic
1112538276 13:100282601-100282623 CACGGTGGGCTGGCACTGCTGGG - Intronic
1112613105 13:100975869-100975891 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1112705861 13:102068647-102068669 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1113330174 13:109319244-109319266 GCGGATGGGCCAGCAGTGCTGGG + Intergenic
1113371950 13:109732860-109732882 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1113506647 13:110821333-110821355 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1113538122 13:111084059-111084081 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1113678065 13:112221890-112221912 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1113680267 13:112238864-112238886 GCAGGTGGGCTGGCAGTGCTGGG - Intergenic
1114155557 14:20099371-20099393 AACGGTGGGCCAGCACTGCTGGG - Intergenic
1114560298 14:23585069-23585091 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1114593544 14:23891930-23891952 GCCGGTGGGTTGGCACTGCTGGG - Intergenic
1115118289 14:29909170-29909192 GCTGGTGGGCTGGCACTGCTGGG - Intronic
1115268625 14:31527275-31527297 ACGGGCGGGCCGGCACTGCTGGG + Intronic
1116152114 14:41154427-41154449 GCGGGCGAGCCGGCAGTGCTGGG + Intergenic
1116251024 14:42482578-42482600 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1116311017 14:43326778-43326800 GCTGGCAGGCTGGCACTGCTGGG - Intergenic
1116390536 14:44384916-44384938 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1116452370 14:45080610-45080632 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1116624024 14:47242617-47242639 GCTGGTGGGCCAGCACTGCTGGG - Intronic
1116656970 14:47665704-47665726 GCTGGTGGGCCAGCAGTGCTGGG - Intronic
1117077875 14:52122417-52122439 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1117297473 14:54393170-54393192 GTGGGCGGGCCGGCAGTGCTAGG + Intergenic
1117297578 14:54393614-54393636 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1117302521 14:54443225-54443247 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1117565642 14:56991193-56991215 GCCCGTGGGCCGGCACTGCTGGG - Intergenic
1117571915 14:57056802-57056824 GCCGGTGGGTCAGCACTGCTGGG + Intergenic
1117622955 14:57606944-57606966 GCAGAGGGGCAGGCACTGCTAGG - Intronic
1118215359 14:63803451-63803473 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1118869303 14:69727871-69727893 GCCTCTGGGCCGGCCCTGCTAGG - Intronic
1119038852 14:71254470-71254492 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1119300308 14:73566520-73566542 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1119486790 14:74994322-74994344 GCCGGTTGGCCGGCACTGCTGGG - Intergenic
1119673441 14:76536937-76536959 GCAGGTGGGCCGGTACTGCTGGG + Intergenic
1119695041 14:76706851-76706873 GCCGGCAAGCCGGCACTGCTGGG + Intergenic
1119870692 14:78014167-78014189 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1120209858 14:81623954-81623976 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1120229756 14:81829643-81829665 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1120330992 14:83092558-83092580 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1120429738 14:84399551-84399573 GTTGGTGGGCCGGCACTGCTGGG + Intergenic
1120439102 14:84513096-84513118 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1120632298 14:86905617-86905639 GCCGGTGGGCCAGCATTGCTGGG + Intergenic
1120704758 14:87734939-87734961 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1120844173 14:89111821-89111843 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1121350653 14:93170304-93170326 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1122493448 14:102135698-102135720 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1122514542 14:102297858-102297880 GCCGGTGGGCCGGCACTGCAGGG - Intronic
1122894812 14:104751685-104751707 GCCGGCGGGCCGGCACTGGTGGG + Intergenic
1123051894 14:105548000-105548022 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1123799150 15:23803087-23803109 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1123949121 15:25253380-25253402 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1124061576 15:26298249-26298271 GCCGCCAGGCCAGCACTGCTGGG + Intergenic
1124114846 15:26831366-26831388 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1124573137 15:30883930-30883952 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1124818463 15:33019665-33019687 ACCAGTGGGCCAGCACTGCTGGG + Intronic
1125112228 15:36047128-36047150 ACCGGTGGAATGGCACTGCTGGG - Intergenic
1125480281 15:40074960-40074982 ACCGGTGGGCCGGCACTGCTGGG + Intergenic
1125565744 15:40677114-40677136 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1125609709 15:40961791-40961813 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1125814726 15:42575167-42575189 GAAGCTGGGCCGGCACTGCTGGG + Intergenic
1125914539 15:43474063-43474085 GCCGGTGGGCTAGCACTGCTGGG + Intronic
1126089003 15:45035008-45035030 GCCGGCGGGCCGGCACTGCTGGG - Intronic
1126128087 15:45314266-45314288 GCTGGTGGGCTAGCACTGCTGGG - Intergenic
1126165522 15:45651194-45651216 ACCTGCGGGCCGGCACTGCTGGG + Intronic
1126639682 15:50812142-50812164 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1126997597 15:54462628-54462650 GCGGGCAGGCCGGCAGTGCTGGG - Intronic
1127211585 15:56779791-56779813 GCTGGTGGGCCAGCACTGCTGGG - Intronic
1127766055 15:62186749-62186771 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1127916457 15:63459259-63459281 GCCGGCAGGCCGGCACTGCTGGG - Intergenic
1127984786 15:64061057-64061079 GCTGGTGGGCCGTCACTGCTGGG - Intronic
1128110855 15:65075198-65075220 GCCGGTGGGCTGGCATTGCTGGG - Intronic
1128141046 15:65301258-65301280 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1128598561 15:68975856-68975878 ACCAGTGGGCCAGCACTGCTGGG + Intronic
1128669972 15:69567545-69567567 GCCTGTGGGCTGGCACTGCTGGG + Intergenic
1128708518 15:69855048-69855070 GCCGGTGGGCATGCCCTGCAAGG - Intergenic
1128813296 15:70587361-70587383 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1129194167 15:73954378-73954400 CCCGAGGGGCCGTCACTGCTGGG - Intergenic
1129280386 15:74480532-74480554 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1129586842 15:76876016-76876038 GCCAGTCGGCCGGCACTGCTGGG + Intronic
1129777489 15:78246324-78246346 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1129859176 15:78847047-78847069 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1129986910 15:79926285-79926307 GCCGGTGGGCCGGCACTACTGGG - Intergenic
1130132874 15:81158796-81158818 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1130228250 15:82076487-82076509 GCCAGTGGGCAGGGACTTCTGGG - Intergenic
1131507796 15:93032001-93032023 GCCGGTGGGCCGGCACGGCTGGG - Intergenic
1132511030 16:341437-341459 TCCGGTGGGCCGGCACTGCCGGG - Intronic
1134245157 16:12534255-12534277 GCAGGTGTGCCGGCGGTGCTTGG - Intronic
1135262112 16:20989828-20989850 ACCGGTGGGCTGGCACTGCTGGG + Intronic
1135280862 16:21152771-21152793 GCCGGTGGGCTAGCACTGCTGGG - Intronic
1135299384 16:21312967-21312989 ACCGGTGGGCTGGCACTGCCGGG + Intergenic
1135751055 16:25059097-25059119 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1136163306 16:28435543-28435565 GCCCGTGGGCTGGCATTGCTGGG - Intergenic
1136199659 16:28679444-28679466 GCCCGTGGGCTGGCATTGCTGGG + Intergenic
1136216005 16:28793617-28793639 GCCCGTGGGCTGGCATTGCTGGG + Intergenic
1136356652 16:29748531-29748553 ACCTGTGGGCTGGCACTGCTGGG - Intergenic
1136547687 16:30964986-30965008 GTCGGTGGGCCGGCTGGGCTCGG - Exonic
1137442519 16:48508863-48508885 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1137945702 16:52731582-52731604 GTTGGTGGGCCGTCACTGCTCGG - Intergenic
1138168848 16:54829991-54830013 GCCGGTGGGGCGGCACTGCTGGG - Intergenic
1138352100 16:56351606-56351628 GCTGCTCGGCCAGCACTGCTGGG + Intronic
1138659592 16:58509390-58509412 ACCGGTGGGCAGGCAGTGCTGGG + Intronic
1138688787 16:58749027-58749049 ACCGGTGGGCCAGCACTGCTGGG - Intergenic
1138693592 16:58790956-58790978 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1139051494 16:63129808-63129830 GCCAGCGGGCCGGCACTGCTGGG - Intergenic
1139125528 16:64072515-64072537 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1139147744 16:64344068-64344090 GCCGGTAGGCCGGCACTGCTGGG - Intergenic
1139603061 16:67998388-67998410 GCCTGTGAGCTGGCACTGCTGGG - Intronic
1139919578 16:70450983-70451005 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1140442515 16:74998904-74998926 GGCGGTGGGTGGGGACTGCTGGG + Intronic
1140722513 16:77784565-77784587 GACAGTGGGCCGGCAGTGCTGGG + Intergenic
1141256354 16:82405814-82405836 GTCGGTGGGCCTCCACTGCGGGG + Intergenic
1141460958 16:84178679-84178701 GCCGGTGGGCCTGTGTTGCTGGG - Exonic
1141465738 16:84204802-84204824 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1141486697 16:84344945-84344967 GCCTGTCGGCCGGCACAGCCAGG - Intergenic
1141798267 16:86289107-86289129 GCGGGTGGGCCGGCATTTCAGGG - Intergenic
1142231564 16:88902509-88902531 GCTGGTGGGCCGGGACTGGGGGG + Intronic
1142262168 16:89048131-89048153 CCTGGAGGGCCGGCGCTGCTGGG + Intergenic
1142293346 16:89202584-89202606 GCCGACGGGCGGGCTCTGCTCGG - Intergenic
1142505675 17:361767-361789 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1143664268 17:8347306-8347328 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1143708643 17:8718263-8718285 CGCGGTGGGCCGGCACTGCTGGG + Intergenic
1144467162 17:15505862-15505884 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1144702635 17:17349036-17349058 GCAGGTGGACAGGCCCTGCTGGG - Intergenic
1144723218 17:17486527-17486549 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1144804663 17:17956678-17956700 ACTGGCGGGCCGGCACTGCTGGG + Intronic
1145050300 17:19654502-19654524 GCTGGTGGGCTGGCATTGCTGGG + Intronic
1145110359 17:20156465-20156487 GCCGCCGGGCAGGCACCGCTGGG + Intronic
1145990157 17:29074469-29074491 GCAGGTGGCCTGGCACTGCATGG - Exonic
1146740459 17:35279101-35279123 GCTGGTGGGCTGGCAGTTCTGGG + Intergenic
1147373633 17:40011108-40011130 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1147431828 17:40376008-40376030 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1147805355 17:43126994-43127016 GCAGGCGGGCCGGCAGTGCTGGG - Intergenic
1147997543 17:44368997-44369019 AGTGGTGGGCTGGCACTGCTGGG - Intergenic
1148016883 17:44528148-44528170 GCCGGTGAGCTGGCACTGCTTGG - Intergenic
1148366167 17:47057469-47057491 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1148740645 17:49890619-49890641 GCCCGGCGCCCGGCACTGCTGGG - Intergenic
1149099251 17:52884162-52884184 GCTGGTGGGCCGGCACCGCTGGG + Intronic
1149753984 17:59172696-59172718 GCCAGTGGGCCAGCACTGCTGGG - Intronic
1149916394 17:60613788-60613810 GCCGGTGGGCCAGCACTGCTGGG - Intronic
1150772293 17:68052046-68052068 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1150778289 17:68099456-68099478 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1150786744 17:68169544-68169566 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1150788280 17:68180022-68180044 ACCCGTGGGCCAGCACTGCTGGG - Intergenic
1151567455 17:74907228-74907250 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1151782667 17:76257834-76257856 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1151840639 17:76615099-76615121 GCGGGCAGGCCGGCAGTGCTGGG + Intergenic
1151983156 17:77526234-77526256 TCGGGCGGGCCGGCAGTGCTGGG + Intergenic
1152210777 17:79001908-79001930 TCCTGAGGGCCGGCACTGCCAGG - Intronic
1152619041 17:81352234-81352256 GCCGGTGCGCCGGCACTGTTGGG + Intergenic
1152715595 17:81899037-81899059 GCCGTGGGGCCGGCGCTGCCAGG + Intronic
1152797386 17:82314967-82314989 GTGGGTGGGCCGGCACTGACAGG + Exonic
1152929382 17:83102073-83102095 GGCAGTGGCCCGGCAGTGCTGGG + Intergenic
1153070388 18:1098401-1098423 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1153644045 18:7178852-7178874 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1153832454 18:8935609-8935631 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1154057232 18:11023833-11023855 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1154231430 18:12559275-12559297 GCAGGCGGGCCAGCAGTGCTGGG + Intronic
1154255302 18:12777041-12777063 GCCGGTGGGCAGGCACTGCTGGG + Intergenic
1154294105 18:13134869-13134891 ACCGGCGGGCCAGCACTGCTGGG + Intergenic
1155208039 18:23577816-23577838 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1155271946 18:24149740-24149762 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1155295023 18:24376766-24376788 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1155772884 18:29723691-29723713 GCTGGTGGGCCAGCACTGCTAGG - Intergenic
1155806295 18:30175304-30175326 GCTGGCGGGCCGGCACTGCTGGG + Intergenic
1155852291 18:30788618-30788640 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1155856369 18:30839345-30839367 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1156038680 18:32794748-32794770 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1156943178 18:42795406-42795428 GCCAGTGGGCTGGCACTGCTAGG - Intronic
1156969685 18:43139695-43139717 ACTGGTGGGCCGGCACTGCTGGG - Intergenic
1157085979 18:44580907-44580929 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1157565476 18:48676502-48676524 GCAGGGGAGCCGGCCCTGCTAGG - Intronic
1157935172 18:51864552-51864574 GCCAGCAGGCTGGCACTGCTGGG + Intergenic
1157979792 18:52367090-52367112 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1158266451 18:55665064-55665086 GCCGGTGGGTCAGCACTGCTGGG - Intergenic
1158351930 18:56572464-56572486 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1158553888 18:58459547-58459569 GCCGGTAGGCCGGCACTGCTGGG - Intergenic
1158697249 18:59714279-59714301 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1158705745 18:59790638-59790660 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1159167943 18:64725825-64725847 GCCGGTGGGCTGGCATTGCTGGG + Intergenic
1159230809 18:65605428-65605450 GCGGGTGGGCGGGCACTGCTGGG - Intergenic
1159260474 18:66006141-66006163 GTCGGTGAGCCGGCACTGCTGGG + Intergenic
1159289328 18:66395996-66396018 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1159472939 18:68880181-68880203 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1159656096 18:71031524-71031546 GCCGGTGGGCGAGCACTGCTGGG + Intergenic
1159743964 18:72209298-72209320 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1160176611 18:76600316-76600338 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1160198565 18:76777419-76777441 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1162091080 19:8280544-8280566 GCTGGCGGGCCGGCACTGCTGGG + Intronic
1162093314 19:8295382-8295404 GCTGGCGGGCCGGCACTGCTGGG + Intronic
1162107008 19:8375938-8375960 GCCGGTGCGCTGGCACTGCTGGG - Intronic
1162230155 19:9259687-9259709 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1162233102 19:9283640-9283662 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1162237655 19:9321567-9321589 GCCAGTGGGCTGGCCCTGCTGGG - Intergenic
1162262045 19:9541513-9541535 ACCAGTGGGCTGGCACTGCTAGG + Intergenic
1162632694 19:11941482-11941504 ACCGGTGGGCTGGCACTACTGGG + Intronic
1162799479 19:13102925-13102947 GCCGGGAGGCCCGCGCTGCTAGG - Intronic
1162814718 19:13186891-13186913 GCCGGTGGGCTGGCGCTGCTGGG + Intergenic
1163181714 19:15608831-15608853 ACCGGTGGGCTGGCACTACTGGG + Intergenic
1163218856 19:15899860-15899882 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1164144021 19:22499175-22499197 GCCGATGGGCTGGCACTGCTGGG + Intronic
1164270576 19:23668713-23668735 GCCAGTGGGCTGGCACTGCTGGG + Intronic
1164310469 19:24041488-24041510 GCCGGTGGGCCAGCACTGCTGGG - Intronic
1164620470 19:29692928-29692950 GCAGGAGGGCCGGCTGTGCTGGG - Intergenic
1164975805 19:32571762-32571784 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1164992060 19:32691891-32691913 GCAGGTGGCCCGGCCCTGCAGGG - Intergenic
1165824429 19:38697792-38697814 GCCTGAGAGCAGGCACTGCTGGG - Intronic
1165846592 19:38821670-38821692 ACCAGCGGGCCGGCACTGCTGGG - Intronic
1166036212 19:40170327-40170349 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1166487007 19:43222118-43222140 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1166649714 19:44563391-44563413 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1167699134 19:51032063-51032085 GCCGCTGTGCCGGATCTGCTCGG + Exonic
1168659899 19:58157477-58157499 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
924977472 2:191544-191566 GCGGGAGGGCCGGCAGTGCTGGG + Intergenic
924987711 2:287542-287564 GCCCGAGGGCCGGGGCTGCTGGG - Intronic
925088688 2:1134909-1134931 ACCGGTGGGCCAGAACTGCTGGG + Intronic
925098966 2:1229785-1229807 GCCGGTGGGCTGGCACTGCTGGG + Intronic
925172591 2:1759483-1759505 GTGGGCGGGCCGGCAGTGCTGGG + Intergenic
925537800 2:4935500-4935522 TCCGGTGGGCTGGCACTGCTGGG + Intergenic
926097502 2:10091591-10091613 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
926616625 2:15002721-15002743 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
927542654 2:23926813-23926835 GCCGGCGGGCCGGCCTTGCTCGG - Exonic
927596593 2:24403033-24403055 GCGGGCAGGCCGGCAGTGCTGGG - Intergenic
928493091 2:31803877-31803899 GCCGGTGGGCTGGCACAGCTGGG - Intergenic
928617934 2:33057614-33057636 GCTGGTGGGCCAGCACTGCTGGG + Intronic
928723112 2:34142722-34142744 GCTGGCGGGCCGGCACTGCTGGG + Intergenic
928880585 2:36092415-36092437 CCTGGTGGACCGGCACTGCTGGG - Intergenic
928936906 2:36688435-36688457 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
929070067 2:38020685-38020707 GCCAGTGAGCCAGCACTGCTGGG - Intronic
929138009 2:38643247-38643269 GCGGGCAGGCCAGCACTGCTGGG + Intergenic
929201864 2:39244449-39244471 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
929233720 2:39585529-39585551 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
929379696 2:41335764-41335786 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
929890861 2:45917858-45917880 GCCCGTGGGCCGGCACTGCTGGG + Intronic
930038021 2:47099906-47099928 ACTGGTGGGCTGGCACTGCTGGG - Intronic
930039221 2:47107454-47107476 ACTGGTGGGCTGGCACTGCTGGG - Intronic
930338753 2:50084395-50084417 GCCGGTGGGCCGGCACTGATGGG + Intronic
930420879 2:51151805-51151827 GCTGGCGGGCTGGCACTGCTGGG + Intergenic
930468215 2:51780498-51780520 GCCGGTGGGCTGGCAGTGCTGGG + Intergenic
930485517 2:52006973-52006995 GCCGGTGGGCGGGCACTGCTGGG - Intergenic
931106982 2:59067102-59067124 GCGCGAGGGCCGGCACTGCTGGG - Intergenic
931708699 2:64969178-64969200 GCACGTGGGCTGGCACTGCTGGG - Intergenic
932239942 2:70148479-70148501 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
932359512 2:71092674-71092696 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
932486487 2:72087055-72087077 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
932521780 2:72422001-72422023 ACCGGTGGGCTGGCACTGCTGGG - Intronic
932902059 2:75711748-75711770 GCCGGTGGGCCGGCACTGCTAGG - Intergenic
933049926 2:77590647-77590669 GCCAGTGGGCCAAGACTGCTGGG - Intronic
933139817 2:78779168-78779190 GCGGGCGGGCTGGCAGTGCTGGG - Intergenic
933487247 2:82938632-82938654 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
934853075 2:97713425-97713447 GCAGCTGGGCAGGCAGTGCTGGG + Intergenic
934898503 2:98139177-98139199 TCCGGTGGGCCGGCACTGCTGGG - Intronic
935148137 2:100410160-100410182 GCCTGTGGGCAGTCACTGCGGGG + Intronic
935710367 2:105893166-105893188 GCCGGGGCGCCGTCACTGCAGGG - Exonic
935866437 2:107392449-107392471 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
935878353 2:107536277-107536299 GTCTGTGGGCCGGCACTGCTGGG + Intergenic
935896843 2:107747525-107747547 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
935922561 2:108031736-108031758 GTGGGTGGGCCAGCAGTGCTGGG - Intergenic
936346894 2:111682024-111682046 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
936581511 2:113704591-113704613 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
936865401 2:117071768-117071790 GCAGGCAGGCCGGCAGTGCTGGG + Intergenic
937181148 2:119997157-119997179 AGCGCTGGGCCGGCACTGCTGGG - Intergenic
937209589 2:120259937-120259959 GCCGGTGGGCCAGCACTGCTGGG + Intronic
937596857 2:123683947-123683969 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
937711841 2:124987596-124987618 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
937746606 2:125422422-125422444 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
937789427 2:125943111-125943133 GCAGGTGGGCCGGCAGTGCTGGG + Intergenic
938126073 2:128672311-128672333 CCCGGTGGGCTGGCACTGCTGGG + Intergenic
938401035 2:130991619-130991641 GCGGGTGGGCTGGCACTGCTGGG - Intronic
938726023 2:134109532-134109554 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
938728780 2:134130097-134130119 GCGGACGGGCCGGCAGTGCTGGG - Intronic
939053205 2:137331794-137331816 GCTCGTGGGCTGGTACTGCTGGG + Intronic
939229767 2:139410514-139410536 GCCGGTGGGCTGGAACTGCTGGG - Intergenic
939281759 2:140073963-140073985 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
939465139 2:142546234-142546256 GCAGGTGGACCAGCACTGCTGGG - Intergenic
939738772 2:145881087-145881109 CCAGGTGGGCTGGCACTGCTGGG + Intergenic
939777349 2:146403878-146403900 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
939869062 2:147507082-147507104 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
939898922 2:147827032-147827054 CCAGGTGGGCCGGCACTGCTGGG - Intergenic
939972535 2:148678587-148678609 ACTGGTGGGCTGGCACTGCTGGG + Intronic
940666698 2:156618244-156618266 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
941178899 2:162235015-162235037 CTCGGTGGGCCAGCACTGCTAGG - Intronic
941309257 2:163909696-163909718 GCAGGCGGGCCAGCACTGCTGGG - Intergenic
941309792 2:163913787-163913809 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
941397922 2:164994941-164994963 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
941705862 2:168657625-168657647 GCCTGTGGACCGGCACTGCTGGG + Intronic
941712115 2:168725084-168725106 GCCAGTGGGCTGGCACTGCTGGG + Intronic
941820800 2:169841707-169841729 GCCGGTGGGCCGGCACTGCTGGG - Intronic
942170248 2:173282775-173282797 CCCGGCGGGCTGGCACTACTGGG + Intergenic
942317589 2:174709763-174709785 GCTGGTGGGCCAGGGCTGCTGGG + Intergenic
942368665 2:175257189-175257211 GCGGGCGGGCCGGTAGTGCTGGG + Intergenic
942540195 2:177008025-177008047 GCCAGTGGGCCGGCACTGCTCGG - Intergenic
942620031 2:177835847-177835869 GCCAGTGGGCCGGCACTGCTGGG - Intronic
942867300 2:180691561-180691583 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
943222843 2:185132773-185132795 CTGGGGGGGCCGGCACTGCTGGG - Intergenic
943222851 2:185132791-185132813 ACTGTCGGGCCGGCACTGCTGGG - Intergenic
943365292 2:186962427-186962449 GCGGGCGGGCCGTCAGTGCTGGG - Intergenic
943494745 2:188606581-188606603 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
943680332 2:190761141-190761163 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
943835167 2:192508142-192508164 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
943941436 2:194002927-194002949 ACCAGTGGGCCAGCACTGCTGGG + Intergenic
943942733 2:194020335-194020357 GCTGTTGGGCCGGCACGGCTGGG - Intergenic
943954926 2:194176487-194176509 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
944176259 2:196831679-196831701 TCCGGTGGGCAGGCACACCTGGG + Intergenic
944228442 2:197370744-197370766 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
944728610 2:202497084-202497106 GCCGGTTGGCTGGCACTGCTGGG - Intronic
944729645 2:202503544-202503566 GCCGGTGGGCTGGCACTGCTGGG - Intronic
944857928 2:203785761-203785783 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
945302559 2:208227881-208227903 GCGGGCGGGCCGGCAGTGCTGGG + Intergenic
945575468 2:211524564-211524586 GCTGGTGGGCTGGCACTGCTGGG + Intronic
945664222 2:212721256-212721278 ACCCATGGGCCGGCACTGCTGGG + Intergenic
945745789 2:213718665-213718687 GCAGGTGGGCCAGCACTGCTGGG - Intronic
945870222 2:215219231-215219253 GCTGGTGGGCCAGCACCGCTGGG - Intergenic
945872819 2:215245915-215245937 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
945995493 2:216432634-216432656 TCCGGTGGGTCAGCACTGCTGGG - Intronic
946358074 2:219201614-219201636 GCCGGTGGGCCGGCACTGCTGGG + Intronic
946686765 2:222278671-222278693 GCTGGTGGGCAGGACCTGCTAGG - Intronic
946923558 2:224603888-224603910 GCCGGTCGGCCGGCACTGCTGGG + Intergenic
946929150 2:224655472-224655494 GCAGGCCGGCCGGCAGTGCTGGG - Intergenic
946982157 2:225229635-225229657 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
947026639 2:225744307-225744329 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
947103805 2:226648181-226648203 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
947171918 2:227320801-227320823 GCAGGTGGGCTGGTAGTGCTGGG - Intergenic
947412001 2:229850891-229850913 GCCGGTGGTCTGGCACTGCTGGG - Intronic
947539350 2:230964423-230964445 GTGGGCGGGCCGGCACTGCTGGG + Intergenic
947584157 2:231342250-231342272 GCCTGCGGGCCAGCACTGCCTGG - Intronic
947720431 2:232366514-232366536 GCCGGTGGTCTGGCACTGCTGGG - Intergenic
947932050 2:233972655-233972677 GCCGGTGGGCCGGCACTGCTGGG + Intronic
947938015 2:234024470-234024492 GCTGGTGGACCAGCACTGCTGGG + Intergenic
947962050 2:234247849-234247871 GCCAGCGGGCTGGCACTGCTGGG - Intergenic
948449102 2:238058040-238058062 GCAGGTGGGCTGGCACTGCTGGG + Intronic
1169814446 20:9641775-9641797 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1169849200 20:10031855-10031877 GCCTGTGAGCTGGCACTGCTGGG - Intronic
1170246477 20:14226681-14226703 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1170649510 20:18226939-18226961 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1170806841 20:19639817-19639839 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1170989893 20:21292045-21292067 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1171318843 20:24220907-24220929 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1171973418 20:31578749-31578771 GCCGGTGGGCCAGCACTGCTTGG + Intergenic
1172431851 20:34898989-34899011 GCTGGTGGGCTGGCACTGCTGGG + Intronic
1173195519 20:40910656-40910678 GCCGGTGGGCTGGCACTACTGGG + Intergenic
1173195696 20:40911357-40911379 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1173601604 20:44299307-44299329 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1173831518 20:46092024-46092046 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1175210075 20:57348570-57348592 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1175254160 20:57628968-57628990 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1176671048 21:9735712-9735734 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1176872244 21:14093157-14093179 ACCAGTGGGCCGGCATTGCTGGG + Intergenic
1176966609 21:15218762-15218784 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1177182380 21:17757774-17757796 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1177496941 21:21902598-21902620 GTCAGTGGGCTGGCACTGCTGGG - Intergenic
1177549107 21:22597973-22597995 GCAGGCGGGCCGGCAGTGCTGGG - Intergenic
1177637627 21:23807189-23807211 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1178398750 21:32265505-32265527 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1178585636 21:33868503-33868525 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1178983343 21:37283371-37283393 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1180086887 21:45511741-45511763 GCAGATGGCCAGGCACTGCTGGG - Intronic
1180962012 22:19766424-19766446 GCGGGCGGGCCAGCAGTGCTCGG + Exonic
1181276294 22:21689132-21689154 GCCTGTGGCCAGGCAGTGCTGGG + Intronic
1181851489 22:25752976-25752998 GCGGGCGGGCCAGCAGTGCTGGG - Intronic
1182479392 22:30597037-30597059 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1183422113 22:37718026-37718048 GCTGGTGGGCGGGCACTGCTGGG + Intronic
1183715192 22:39529310-39529332 GCTGGTGGGCCGGAAGTCCTGGG - Exonic
1183990366 22:41593695-41593717 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1184035135 22:41914636-41914658 GCCGGGGCGCGGGGACTGCTCGG - Exonic
1184562705 22:45272669-45272691 GCCGCTGGTCAGGCACTGCCTGG + Intergenic
1184584265 22:45436902-45436924 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1184906244 22:47488493-47488515 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1185229116 22:49670388-49670410 GCCGGGGGGCCGGCACTGCTGGG + Intergenic
949281497 3:2352564-2352586 ACTGGCGGGCTGGCACTGCTGGG - Intronic
949292761 3:2485082-2485104 ACTGGCCGGCCGGCACTGCTGGG - Intronic
949770002 3:7568770-7568792 GCCAGTGGGCCGGTACTGTTGGG - Intronic
950203608 3:11061547-11061569 GCCAGTGGGCGGGCACTGCTGGG - Intergenic
950204846 3:11071409-11071431 GCAGGCAGGCCGGCAGTGCTGGG + Intergenic
950207901 3:11094210-11094232 AGCGGTGGGTCTGCACTGCTGGG - Intergenic
950256648 3:11511782-11511804 ACCGGTGGGCTGGTACTGCTGGG + Intronic
950256952 3:11513429-11513451 ACCAGTGGGCCAGCACTGCTGGG + Intronic
950401004 3:12769054-12769076 GCCAGTAGGCTGGCATTGCTGGG + Intronic
950513355 3:13447383-13447405 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
950600369 3:14029681-14029703 GCCGGTGGGCTGGCACTGCTGGG + Intronic
950601234 3:14037372-14037394 GCAGGCGGGCCGGCACTGCTGGG - Intronic
950929404 3:16773890-16773912 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
951024850 3:17817872-17817894 ACTGGTGGGCCAGCACTGCTGGG + Intronic
951184972 3:19702703-19702725 GCCGGCGCTCCGGCACTGCTGGG - Intergenic
951323195 3:21271808-21271830 GCGGGTGGGCCAGCAGTGCTGGG + Intergenic
951415447 3:22417126-22417148 GCAGGTGGGCTGGCACTGCTGGG - Intergenic
951551874 3:23882722-23882744 GCTGGCAGGCTGGCACTGCTGGG + Intronic
951951079 3:28200599-28200621 GCCGGTGGGCTGGTACTGCTGGG + Intergenic
952058081 3:29473688-29473710 GCCAGTGGGCCGGCACTGCTGGG + Intronic
952275258 3:31870293-31870315 GCCAGTGGGCCGGGACTGCTGGG - Intronic
952355398 3:32578926-32578948 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
952360481 3:32625818-32625840 TCGAGTGGGCCGGCACTACTGGG - Intergenic
952393724 3:32902968-32902990 GCCTGTGGGCCGGCACTGCTGGG - Intergenic
952398241 3:32939857-32939879 GCCTGTGGGCTGGCACTGCTGGG - Intergenic
952453699 3:33453623-33453645 TGGGGTGGGCCAGCACTGCTGGG - Intergenic
952593648 3:34988550-34988572 GCCGGTGGCCTGGCACTGCTGGG - Intergenic
952730651 3:36634081-36634103 GCTGGTGGGCTAGCACTGCTGGG - Intergenic
953002901 3:38951325-38951347 GCCAGTGGGCCGACTCTGCTGGG - Intergenic
953089836 3:39713490-39713512 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
953096284 3:39779919-39779941 GCAGGCAGGCCGGCAGTGCTGGG - Intergenic
953124504 3:40078113-40078135 GCCGGTGGGCTGGCACTGCTGGG + Intronic
953522485 3:43656613-43656635 GCCGGTGGGCTAGCACTGCTGGG + Intronic
953714613 3:45306843-45306865 ACCGGTGGGCCGGTACTGCTGGG - Intergenic
954041015 3:47887380-47887402 ACTTATGGGCCGGCACTGCTGGG - Intronic
954410057 3:50366611-50366633 GCTGTTGGGGCCGCACTGCTGGG + Exonic
954620140 3:51990746-51990768 GCCGGTGGCCTGGCACTGCTGGG - Intergenic
955183361 3:56692053-56692075 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
955186435 3:56719106-56719128 GCCGGCAGGCTGGCACTGCTGGG - Intergenic
955210294 3:56934639-56934661 GCTGGTGGGCTGGCACTGCTGGG - Intronic
955219674 3:57013037-57013059 GCAGGCCGGCCGGCAGTGCTGGG - Intronic
955266452 3:57449532-57449554 GCTGGTGGGCTGGCACTGCTGGG + Intronic
956183933 3:66544843-66544865 GCCGTTGGGCAAGTACTGCTGGG + Intergenic
956438830 3:69260448-69260470 GCAGGTGGGCCAGCAGTGCTGGG - Intronic
956459232 3:69454611-69454633 GTGGGCGGGCCGGCAGTGCTGGG - Intronic
956481468 3:69677627-69677649 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
956855267 3:73269367-73269389 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
957009173 3:74985312-74985334 GCCCGTGGGCTGGCACTGCTGGG + Intergenic
957209425 3:77240273-77240295 GCGGGTGGGCTGGCAGTGCTGGG + Intronic
957277477 3:78108562-78108584 ACCCATGGGCCAGCACTGCTGGG - Intergenic
957362086 3:79173510-79173532 CCCGGTGGGCCGGCACTGCTGGG - Intronic
957371492 3:79300393-79300415 GCCGGTGGGCCGGCACTGCTGGG - Intronic
957419661 3:79951557-79951579 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
957556287 3:81767573-81767595 ACCGGTGGGCCGGCACTGCTGGG + Intergenic
957560157 3:81812195-81812217 GCCGGTGGGCTGGCACTGCTAGG + Intergenic
957665171 3:83217797-83217819 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
957804898 3:85134047-85134069 GCCGGTGGGCTGGCACTGCTGGG + Intronic
957830006 3:85504862-85504884 GCCGGTGGGCCGGCACTGCTGGG + Intronic
957921829 3:86757771-86757793 ACGGACGGGCCGGCACTGCTGGG - Intergenic
957995112 3:87679272-87679294 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
958022642 3:88015863-88015885 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
958419883 3:93917760-93917782 GCCAGTGGGCCAGCACTGCTGGG - Intronic
958549635 3:95595667-95595689 GCAGGTGGGCCAGCTGTGCTGGG + Intergenic
959422749 3:106148801-106148823 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
959462464 3:106643944-106643966 GAAGGTGGGCCGGCAGTGCTGGG - Intergenic
960149794 3:114238476-114238498 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
960227529 3:115185074-115185096 GCCGGTGGGCTGGCACGGCTGGG + Intergenic
960282147 3:115791736-115791758 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
960487320 3:118269831-118269853 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
960560033 3:119073589-119073611 GCCGGTGGGCCGGCAGTGCTGGG + Intronic
960669213 3:120140423-120140445 GCCGGCGGGCCAGCACTGCTGGG - Intergenic
960761664 3:121078740-121078762 GCCAGTGGGCCAGCACTGCTGGG + Intronic
961268788 3:125671851-125671873 GCCAGCAGGCCAGCACTGCTGGG - Intergenic
961460474 3:127046851-127046873 GCCTGTGGGCTGGCACTGCTGGG - Intergenic
961461949 3:127056294-127056316 GCTTGTGGGCCGGCACTGCTGGG + Intergenic
961688813 3:128653573-128653595 GCCCGTGGGCCGGCACTGCTGGG - Intronic
962177236 3:133167578-133167600 ACGGGTGGGCCGGCAGTGCTGGG + Intronic
962283743 3:134070447-134070469 GCCGGTGGGCTGGCACTGCTGGG + Intronic
962383756 3:134916546-134916568 TCCAGTGGGCTGGCACTTCTGGG + Intronic
962591066 3:136890184-136890206 GCTGGTGGGCTGGCATTGCTGGG + Intronic
962671687 3:137714709-137714731 TCCGGTGGGCCGGCACTGATGGG + Intergenic
962758259 3:138484823-138484845 GCCGGTGGGCTGGCACTGCAGGG - Intergenic
963397220 3:144749986-144750008 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
963440413 3:145333552-145333574 TCCGCTGGGCTGGCACTGCTGGG - Intergenic
963519384 3:146345702-146345724 GCCCATAGGCCTGCACTGCTTGG + Intergenic
963533274 3:146497472-146497494 CCTGGTGGGCCAGCACTGCTGGG - Intergenic
963554672 3:146772519-146772541 GCCGGTGTAATGGCACTGCTGGG - Intergenic
963651819 3:147989567-147989589 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
963862180 3:150323142-150323164 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
964014389 3:151928329-151928351 GCCGGTGGGCTGGCACTGCCGGG - Intergenic
964032326 3:152152590-152152612 CCAGGTGGGCTGGCACTGCTGGG - Intergenic
964037550 3:152217476-152217498 GCCGGTGGGTCGGCACTGCTGGG - Intergenic
964117962 3:153155913-153155935 ACCGGTGGGCCGGCACTGCTGGG + Intergenic
964138353 3:153369942-153369964 ACGGATGGGCCGGCAGTGCTGGG + Intergenic
964139209 3:153378522-153378544 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
964265371 3:154889426-154889448 GGCGGCGGGCCGGCACTGCTGGG + Intergenic
964376269 3:156051940-156051962 GCCGGCGGGCTGGCAGTGCTGGG - Intronic
964393773 3:156224108-156224130 GCCGGTGGGCCAGCACTGCTGGG + Intronic
964444012 3:156740752-156740774 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
964452134 3:156822863-156822885 GCCAGTGGGCTGGCACTGCGGGG + Intergenic
964751870 3:160060698-160060720 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
964974182 3:162599872-162599894 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
964977767 3:162640244-162640266 GCAAGTAGGCTGGCACTGCTGGG - Intergenic
964982496 3:162703111-162703133 GCCAGTGGGCTGGCAATGCTAGG + Intergenic
965040304 3:163499196-163499218 GCCCGTGGGCCGGCACTGCTGGG - Intergenic
965044124 3:163552508-163552530 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
965078000 3:164003142-164003164 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
965109414 3:164402076-164402098 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
965200335 3:165649503-165649525 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
965220207 3:165918635-165918657 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
965220891 3:165924524-165924546 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
965245231 3:166258654-166258676 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
965288050 3:166842986-166843008 GCCGGTGGGCGGGCACTGCTGGG - Intergenic
965744211 3:171907252-171907274 ACCGGCAGGCCAGCACTGCTGGG + Intronic
965753222 3:171999057-171999079 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
965837378 3:172866956-172866978 GCAGGTGGGCTGGCACTGCTGGG - Intergenic
965943476 3:174212158-174212180 GCCGGTGGGCCGGCACTGCTGGG + Intronic
966076074 3:175937547-175937569 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
966096780 3:176213606-176213628 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
966108198 3:176362409-176362431 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
966186152 3:177228791-177228813 CCGGGTGGGCCAGCAGTGCTGGG + Intergenic
966191007 3:177271915-177271937 GCCGGTGGGCTGGCGCTGCTGGG + Intergenic
966725012 3:183101071-183101093 GCCGGTGGGCCAGCACTGCTGGG - Intronic
966725424 3:183103932-183103954 GCCGGTGGGCCGGCACTGCTGGG + Intronic
967234093 3:187367757-187367779 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
967448513 3:189596298-189596320 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
967499145 3:190177235-190177257 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
967718362 3:192789206-192789228 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
968181588 3:196599223-196599245 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
969440752 4:7215303-7215325 GCCGGTAGGCTGGCACTGCTGGG - Intronic
969654966 4:8491596-8491618 GCCGGTGGGCCGGCACTGCTGGG + Intronic
970182602 4:13415568-13415590 GCCAGTGGGCCGGCACTGCTGGG - Intronic
970391226 4:15615088-15615110 GCCGGTGGGCTGGCACTGCTGGG - Intronic
970408639 4:15786921-15786943 GCCAGTGGGCCAGCACTGCTGGG + Intronic
970574569 4:17414473-17414495 GCGGGCGGGCAGGCAGTGCTGGG + Intergenic
970615749 4:17766993-17767015 GCCAGCGGGCCAGCACTGCTGGG + Intronic
970649316 4:18159455-18159477 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
970673157 4:18418524-18418546 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
970803538 4:20004186-20004208 GCCGGTGGGATGGCACTGCTGGG - Intergenic
971553030 4:27978521-27978543 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
971563576 4:28112954-28112976 GCCTGTGGGCCGGCACCACTGGG - Intergenic
971618769 4:28828170-28828192 GCAGGCGGGCCGGCAGTGCTGGG - Intergenic
971635117 4:29047694-29047716 CCTGGTGGGCCAGCACTGCTGGG - Intergenic
971639834 4:29117528-29117550 GCCGGTTGGCTGGCACTGCTGGG - Intergenic
971709475 4:30092881-30092903 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
971792344 4:31185153-31185175 GCCAGCGGGCTGGCACTGCTGGG + Intergenic
971811964 4:31438826-31438848 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
971852105 4:31996563-31996585 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
971905187 4:32716411-32716433 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
972173380 4:36375122-36375144 GCCGGCAGACCGGCACTGCTGGG - Intergenic
972360933 4:38325102-38325124 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
972392560 4:38627077-38627099 GCCGGTGGGTCAGCACTGCTGGG - Intergenic
972505773 4:39718687-39718709 GCTGGTGGGCCAGCACTGCTGGG + Intronic
972890478 4:43551388-43551410 CCCAGTGGGCCGGCACTGCTGGG - Intergenic
972900138 4:43672532-43672554 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
972913313 4:43846343-43846365 ACAGGTGGGCCGGCAGTGCTGGG - Intergenic
973037108 4:45420331-45420353 CCCAGTGGGCCGGCACTGCTGGG - Intergenic
973039931 4:45457301-45457323 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
973041796 4:45477535-45477557 GCCAGTGGGCTGGCATGGCTGGG + Intergenic
973045394 4:45530630-45530652 GCGGGCGGGCCAGCAGTGCTGGG - Intergenic
973048583 4:45567227-45567249 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
973146329 4:46831212-46831234 GTTGGTGGGCCGGCACTGCTGGG - Intronic
973190302 4:47378237-47378259 GCCAGTGGGCCAGCACTGATGGG + Intronic
973308089 4:48675515-48675537 GCTGGTGGGCTGGCACTGCTGGG - Intronic
973587755 4:52409932-52409954 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
973817592 4:54632711-54632733 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
974089877 4:57300355-57300377 GCAGGTGGGCCAGCACTGCTGGG + Intergenic
974128945 4:57729956-57729978 ACCGGTGGTCCAGCACTGCTGGG + Intergenic
974147429 4:57965599-57965621 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
974484778 4:62492082-62492104 ACCGGTGGGCTGGCGCTGCTGGG + Intergenic
974641736 4:64640659-64640681 GCTGGTGGGTCCGCACTGCTGGG + Intergenic
974781737 4:66561675-66561697 GCCGGTGGGCCTGCACAGCTGGG + Intergenic
974792759 4:66712600-66712622 GTCGGTGGACCGGCACTGCTGGG + Intergenic
974804394 4:66860343-66860365 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
974827769 4:67152054-67152076 GCCGGTGGGCTGGCACTTCTGGG - Intergenic
974892285 4:67896748-67896770 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
974992863 4:69115430-69115452 GCCAGTGGGCGGGCACTGCTGGG + Intronic
975055413 4:69924065-69924087 GCCGTTGGGCTGGCACTGCTGGG - Intergenic
975596356 4:76050843-76050865 GCCAGTGGGCTGGCACTGCTGGG + Intronic
975754824 4:77562042-77562064 CCTGGTGGGCCAGCACTGCTGGG - Intronic
975755880 4:77570838-77570860 ACCGGTGGGCTGGCACTGCTTGG - Intronic
975898443 4:79122107-79122129 GCCGGTGGGCCGGCACTGTTGGG - Intergenic
976102500 4:81580625-81580647 GCTGACGGGCCAGCACTGCTGGG - Intronic
976406390 4:84664865-84664887 GCCCGTGGGCCGGCACTGCTGGG - Intergenic
976520618 4:86021793-86021815 GCCGGTGGGCCGGCACTGCTGGG + Intronic
976646859 4:87396132-87396154 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
976690597 4:87863854-87863876 GCCGGGGGGCCGGCACTGCTGGG + Intergenic
976980286 4:91218155-91218177 CACGGTGGGCCGGCACTGCTGGG + Intronic
977206532 4:94170019-94170041 GCAGGTGGGCCGGCACTGCTGGG - Intergenic
977416672 4:96742693-96742715 ACCAGTGGGCTGGCACTGCTGGG - Intergenic
977470693 4:97438271-97438293 GCTGGTGGGCCAGCACTGCTGGG + Intronic
977606925 4:98993672-98993694 ACTGGTGGGCCGGCACTGCTGGG + Intergenic
977717338 4:100196706-100196728 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
977750955 4:100608951-100608973 GCCGGTGGGCTGGCACTGCTGGG + Intronic
977885757 4:102250474-102250496 GCGGGTGGGCCGGCACTGCTGGG + Intergenic
977906491 4:102483301-102483323 ACCGGTAGGCTGGCACTGCTGGG - Intergenic
978030601 4:103936952-103936974 CCCGGCGGGCTGGCACTGCTGGG - Intergenic
978207189 4:106092587-106092609 GCTGGTGGGCCAGCACTGCTGGG + Intronic
978241875 4:106525531-106525553 GCCAGCGGGCCGGCACTGCTGGG + Intergenic
978254876 4:106681640-106681662 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
978285535 4:107073269-107073291 ACTGGTGGGCCAGCACTGCTGGG - Intronic
978748575 4:112222607-112222629 GCTGGTGGGCCAGCAGTGCTGGG - Intergenic
978809099 4:112830981-112831003 ACAGGTGGGCCAGCAGTGCTGGG - Intronic
978998035 4:115179604-115179626 GCCGGTGGGCCGGCAGTGCTGGG + Intergenic
978999568 4:115200380-115200402 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
979224200 4:118265732-118265754 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
979290811 4:118977236-118977258 GCCGGTGGGCCAGCACTGCTGGG + Intronic
979308331 4:119173960-119173982 GCCGGTGGGCTGGCACTGCTGGG - Intronic
979424742 4:120550923-120550945 GCAGGTGGGCCAGCGCTGCTGGG + Intergenic
979609025 4:122670390-122670412 GCCGGCAGGCCAGCACTGCTGGG - Intergenic
979688598 4:123538091-123538113 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
979825694 4:125229765-125229787 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
979899700 4:126201477-126201499 GCCGGTGGGCTGGAAGTGCTGGG + Intergenic
979991472 4:127380109-127380131 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
980043369 4:127964423-127964445 GCCAGTGGGCTGGCACTGCTGGG + Intronic
980051920 4:128047744-128047766 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
980227991 4:130012955-130012977 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
980230243 4:130038728-130038750 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
980470220 4:133240594-133240616 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
980628604 4:135406793-135406815 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
980698760 4:136395520-136395542 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
980774502 4:137421195-137421217 GCCGGCGGGCCGGCACTGCTGGG - Intergenic
980799767 4:137733910-137733932 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
980815562 4:137942245-137942267 GCTGGTGGGCCGGCAGTGCTGGG - Intergenic
980865922 4:138553318-138553340 GCGGGCGGGCCGGCAGTGCTGGG - Intergenic
981146713 4:141333204-141333226 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
981169551 4:141605581-141605603 GCCCGTGGGCCACCACTGCTGGG + Intergenic
981176581 4:141690044-141690066 GCTGGTGGGCTGGCACTGCTGGG + Intronic
981275827 4:142897671-142897693 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
982408237 4:155044477-155044499 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
982679109 4:158408240-158408262 GCCGGTGGGCCGGCACTGCTGGG - Intronic
982728200 4:158927876-158927898 GCAGGTGGGCTGGGACTGCTGGG - Intronic
982768944 4:159378272-159378294 GTGGGTGGGCCGGCAGTGCTGGG - Intergenic
982770158 4:159390134-159390156 ACGGGTGGGCCGGCAGTGCTGGG - Intergenic
982814570 4:159869219-159869241 GCCCGTGGGCTGGCACTGCTGGG + Intergenic
982863390 4:160481934-160481956 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
982868795 4:160550294-160550316 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
982921281 4:161277425-161277447 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
982985773 4:162203762-162203784 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
983026108 4:162739715-162739737 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
983060347 4:163153020-163153042 GCTGCTGGGCTGGCACTGCTGGG - Intronic
983064079 4:163189901-163189923 GTCGGTAGGCTGGCACTGCTGGG + Intergenic
983290661 4:165799584-165799606 ACCGGCGGACTGGCACTGCTGGG + Intergenic
983369760 4:166843011-166843033 CCCAGTGGGCCGGCGCTGCTGGG + Intronic
983553045 4:169036021-169036043 GCCGGTCGGCTGGCACTGCTGGG + Intergenic
983656747 4:170091403-170091425 GCCGGTGAGCCGGCATTGCTGGG - Intronic
983734722 4:171043333-171043355 GCCAGTCGGCTGGCATTGCTGGG - Intergenic
983843168 4:172482058-172482080 GCAGGTGGCCCAGCAGTGCTGGG + Intronic
984192826 4:176625351-176625373 GCCGGTGGGCTGGCACTGTTGGG + Intergenic
984238808 4:177193382-177193404 GCCTGTAGGCTGGCACTGTTGGG + Intergenic
984265667 4:177495766-177495788 GCCGGTTGGCTGGCACTGCTGGG - Intergenic
984275738 4:177607301-177607323 GCTGGTGGGCGGGCATTGCTGGG + Intergenic
984662257 4:182386725-182386747 GCCGGTGGGCTGGCACTGCTGGG - Intronic
984728666 4:183045251-183045273 AGCGCAGGGCCGGCACTGCTGGG - Intergenic
984770574 4:183433319-183433341 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
984776101 4:183482878-183482900 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
984862489 4:184253112-184253134 ACGGGCGGGCCGGCAGTGCTAGG - Intergenic
984918113 4:184741381-184741403 GCTGGCAGGCCGGCACTGCTGGG - Intergenic
984948709 4:184990274-184990296 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
985087110 4:186324758-186324780 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
985145440 4:186890288-186890310 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
985182300 4:187278651-187278673 CCCCGTGGGCAGGGACTGCTAGG + Intergenic
985195163 4:187421130-187421152 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
985203260 4:187505805-187505827 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
985269309 4:188179136-188179158 CTGGGTGGGCCGGCAGTGCTGGG - Intergenic
985366412 4:189236482-189236504 GCCGGTGGGCTGGCACTGCTTGG - Intergenic
985403862 4:189616832-189616854 ACAGGTGGGCCGGCACTGCTGGG + Intergenic
985593649 5:778008-778030 GCAGGCGGGCTGGCAGTGCTGGG + Intergenic
986121145 5:4837712-4837734 GCCGGTGGGCCGGCCCTGCTGGG - Intergenic
986152012 5:5137960-5137982 CCCGGTGGGCCGGCACTGCTGGG - Intergenic
986333321 5:6734198-6734220 GCCGCTGGGTGGGCACGGCTGGG + Intronic
986626176 5:9725492-9725514 GCCGGTAGGCCGGCACTGCTGGG - Intergenic
986661755 5:10065664-10065686 GCTGGTGGGCCGGCACTGTTGGG - Intergenic
986698005 5:10375331-10375353 GCCGGTGGGCCGGCACTGCTGGG - Intronic
986912375 5:12574130-12574152 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
986963600 5:13244363-13244385 GGTGGCAGGCCGGCACTGCTGGG - Intergenic
987146238 5:14993991-14994013 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
987156779 5:15096741-15096763 GCCGTTGGGCTGGCACTGCTGGG + Intergenic
987283740 5:16436357-16436379 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
987315307 5:16718126-16718148 GCCGGTGGGCTGGCACTGCCTGG - Intronic
987358234 5:17083625-17083647 GCCGGTGGGCCAGCACTGCTGGG - Intronic
987383999 5:17311958-17311980 GCCTGTGGGCCGGCACTGCTGGG + Intergenic
987476685 5:18399858-18399880 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
987532773 5:19142956-19142978 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
987543839 5:19287919-19287941 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
987876959 5:23691299-23691321 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
987896300 5:23951471-23951493 GCCGGTGGGCTGTCACTGCTGGG - Intronic
987990239 5:25200209-25200231 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
988073512 5:26324635-26324657 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
988086979 5:26485465-26485487 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
988132170 5:27120073-27120095 GCTGGTGGGCTGGCACTGCTGGG - Intronic
988143048 5:27267384-27267406 GCGGGTGGGCCGGCAGTGCAGGG + Intergenic
988155044 5:27439636-27439658 GCCGGTGGGCCGGCACTACTGGG + Intergenic
988177276 5:27743636-27743658 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
988279544 5:29127808-29127830 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
988369249 5:30345902-30345924 GTCGGTGGGCCGGCACTGCTGGG - Intergenic
988500142 5:31777277-31777299 GCGGGCGGGCCAGCAGTGCTGGG - Intronic
988684724 5:33515572-33515594 GCCAGTGGGCTGGCACAGCTGGG + Intergenic
988883599 5:35531801-35531823 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
988915886 5:35893053-35893075 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
989003211 5:36782755-36782777 GCCGGTGGGCTAGCACTGCTGGG - Intergenic
989346804 5:40438834-40438856 GTCGGTGGGCTGGCACTGCTGGG - Intergenic
989559688 5:42836543-42836565 GCCAGCAGGCCGGCACTGCTGGG - Intronic
989950582 5:50293024-50293046 ACTGGAGGGCCAGCACTGCTGGG - Intergenic
989956858 5:50369613-50369635 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
989957936 5:50377005-50377027 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
989965837 5:50465189-50465211 ACCGGTGGGCTGGCGCTGCTGGG - Intergenic
990323167 5:54649207-54649229 ACCCGTGGGCCAGCACTGCTGGG + Intergenic
990345275 5:54865251-54865273 GCTGGCGGGCTGGCACTGCTGGG - Intergenic
990461533 5:56035664-56035686 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
990490078 5:56295499-56295521 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
990512143 5:56498843-56498865 GCCGGTGGGCTGGCACTGTTGGG + Intergenic
990544973 5:56814481-56814503 GCCGGTGGCCCGACCCTGCAGGG + Intergenic
990665707 5:58069320-58069342 GCCGGCGGGCCAGCACTGCTGGG + Intergenic
990753192 5:59039733-59039755 GCCGGGGGGATGGCACTGCGAGG - Intronic
991214956 5:64150254-64150276 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
991505429 5:67319036-67319058 GCCAGGGGGCTGGCACTGCTGGG - Intergenic
991657806 5:68921042-68921064 GCCAGCGGGCCGGCTCTGCTGGG - Intergenic
992296749 5:75333860-75333882 GCCGGTGGGCTGGCACTGCTAGG - Intergenic
992947456 5:81823897-81823919 GTCGGTGGGCTGGCACTGCTGGG - Intergenic
993031880 5:82714864-82714886 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
993320924 5:86466867-86466889 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
993328567 5:86569709-86569731 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
993593854 5:89828124-89828146 GCGGGTGGGCGGGCTCTGCCTGG + Intergenic
993770300 5:91917451-91917473 GCCGCTGGGCCGGCACTGCTAGG - Intergenic
993822047 5:92631506-92631528 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
994096353 5:95851342-95851364 GCCGGTGGGCCGGCACTGCTAGG - Intergenic
994167019 5:96618677-96618699 GTCAGTGAGCCGGCACTGCTGGG - Intronic
994229976 5:97301323-97301345 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
994251507 5:97542066-97542088 GCCGGTGGGCCGGCACTGCCGGG + Intergenic
994254783 5:97580180-97580202 GCCGGTGTACTGGCACTGCTGGG + Intergenic
994507120 5:100656937-100656959 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
994509833 5:100689054-100689076 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
994605591 5:101962631-101962653 GCTAGTGGGCTGGCACTGCTGGG + Intergenic
994620354 5:102155113-102155135 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
994669764 5:102752240-102752262 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
994701689 5:103142220-103142242 GCCGGTGGGCTGGCACTGCCGGG + Intronic
994769779 5:103966512-103966534 GCTGCTGGGCTGGCACTGCTGGG + Intergenic
994841404 5:104929178-104929200 ACCCGTGGGCCGGCACTGCTGGG - Intergenic
995032331 5:107494418-107494440 GCCAGTGGGCTGGCGCTGCTGGG - Intronic
995388335 5:111612351-111612373 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
995568686 5:113457319-113457341 AACGGTGGGCTGGCACTGCTGGG - Intronic
995582639 5:113617489-113617511 GCGCATGGGCCGGCAGTGCTGGG - Intergenic
995596444 5:113753304-113753326 ACCGCTGTGCCAGCACTGCTGGG + Intergenic
995656516 5:114432855-114432877 GCTGGTGAGCTGGCACTGCTGGG - Intronic
995678917 5:114695634-114695656 GTGGGTGGGCCGGCAGTGCTGGG - Intergenic
995679857 5:114704474-114704496 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
995700370 5:114929011-114929033 ACTGGCGGGCCAGCACTGCTGGG - Intergenic
995920409 5:117304837-117304859 GCCGGTGGGCGGGCACTGCTGGG - Intergenic
995975820 5:118033951-118033973 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
996234233 5:121107352-121107374 GCCAGTCGGCTGGCACTGCTGGG - Intergenic
996298546 5:121954124-121954146 GCGGGTGGGCCGGCAGTGCTGGG + Intergenic
996435702 5:123430721-123430743 GCCGGTGGGCTGGCACTGCTCGG - Intergenic
996530403 5:124521797-124521819 GCTGGTGGGCCAGCACTGCCGGG - Intergenic
996575888 5:124976300-124976322 GCACGTGGGCTGGCAGTGCTGGG + Intergenic
997375513 5:133394528-133394550 CCCGGTGGGCCGGCACTGCTGGG - Intronic
998117548 5:139549518-139549540 GCAGGTGGGCCTGCAGTGCTGGG - Intronic
999406193 5:151309367-151309389 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
999855272 5:155586937-155586959 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1000066044 5:157694013-157694035 GCCTGTGGGCTGGCACTGCTGGG - Intergenic
1000084753 5:157879456-157879478 ACAGGTGGGCCGGCAGTGCTGGG - Intergenic
1000085876 5:157887023-157887045 ACAGGTGGGCCGGCAGTGCTGGG - Intergenic
1000329179 5:160194082-160194104 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1000547621 5:162622018-162622040 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1000891809 5:166810381-166810403 GCCGGTGGGCCGGCACTCCTGGG + Intergenic
1000902474 5:166927133-166927155 TCCGGCAGGCCAGCACTGCTGGG + Intergenic
1001841555 5:174880843-174880865 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1001843571 5:174901693-174901715 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1002004625 5:176222210-176222232 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1002221754 5:177688410-177688432 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1002616461 5:180459344-180459366 ACCAGCAGGCCGGCACTGCTGGG - Intergenic
1002681624 5:180969656-180969678 GTGGGTGGGCTGGCAGTGCTGGG + Intergenic
1002758031 6:179768-179790 ACCGGTGGGCCGGCACTGCTCGG - Intergenic
1002789365 6:426386-426408 GCCGGTGGTTTGTCACTGCTGGG + Intergenic
1002793215 6:450156-450178 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
1002907015 6:1457156-1457178 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1003069681 6:2935983-2936005 GCCGGTGGGCCAGCAGTGCTGGG - Intergenic
1003081924 6:3027876-3027898 GCCCGTGGGCTGGCACTGCTGGG - Intergenic
1003100201 6:3170941-3170963 GCCGGTGGGTTGGCACTGCTGGG - Intergenic
1003111281 6:3253746-3253768 GCGGGCGGGCCGGCAGTGCTGGG - Intronic
1003224459 6:4191476-4191498 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1003508830 6:6762666-6762688 GCTGGTGGGCCGGCACTGCTTGG + Intergenic
1003531386 6:6940267-6940289 GCCGGTGGGCCGGTATTGTTGGG - Intergenic
1003581455 6:7344391-7344413 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1003671551 6:8164508-8164530 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1003717658 6:8665964-8665986 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1003717709 6:8666144-8666166 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1003736905 6:8887341-8887363 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1003748019 6:9024440-9024462 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1003749591 6:9040934-9040956 CACCGTCGGCCGGCACTGCTGGG - Intergenic
1003770145 6:9290625-9290647 GCCGGCGGGCTGGCACTGCTGGG + Intergenic
1003824922 6:9942350-9942372 GTTGGTGGGCCGGCACTGCTGGG - Intronic
1003845739 6:10171899-10171921 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1003862803 6:10337586-10337608 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1003901606 6:10660061-10660083 CTCGGTGGGCCGGCACTGCTGGG - Intergenic
1003908139 6:10720764-10720786 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1003956690 6:11171240-11171262 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1003982456 6:11402767-11402789 GCCGGTGGGCCGGCACTGGTGGG + Intergenic
1003983969 6:11417178-11417200 GCGGGTGGGCCAGCAGTGTTTGG + Intergenic
1004036977 6:11933256-11933278 GCCGGTGGGCTGACACTGCTGGG - Intergenic
1004045354 6:12018106-12018128 ACCAGTGGGCCGGCACTGCTGGG + Intronic
1004053142 6:12108575-12108597 GCTGGTGGGCTGGCACTGCTGGG + Intronic
1004196575 6:13511220-13511242 GCCAGTGGGCCGGCACTACTGGG + Intergenic
1004200277 6:13541716-13541738 GCCGCTGGGCCGGCACTGCTGGG - Intergenic
1004217591 6:13716926-13716948 GCCGGCAGGCCGGCACTGCTGGG - Intergenic
1004220626 6:13743379-13743401 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1004224405 6:13772664-13772686 GCCGGTGGGCTGGCACTGTTGGG - Intergenic
1004234278 6:13860313-13860335 ACCGGTGGGGCAGCGCTGCTGGG - Intergenic
1004235534 6:13872107-13872129 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1004354082 6:14916158-14916180 ACCGGCGGGCCGGCACTGCTGGG - Intergenic
1004452376 6:15758943-15758965 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1004483219 6:16040520-16040542 ACAGGTGGGCCGGCAGTGCTGGG + Intergenic
1004486266 6:16069402-16069424 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1004501904 6:16216995-16217017 GCCAGTGGGCCGGCGCTGCTGGG - Intergenic
1004503195 6:16227083-16227105 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1004587447 6:17016010-17016032 GCGGGCGGGCCGGCAGTGGTGGG + Intergenic
1004663316 6:17728923-17728945 CCCGGTGGACCGGCACTGCTTGG - Intergenic
1004665518 6:17745492-17745514 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1004689080 6:17976373-17976395 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1004694401 6:18020195-18020217 ACTAGTGGGCCAGCACTGCTGGG - Intergenic
1004866042 6:19854612-19854634 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1004906922 6:20244956-20244978 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1004912643 6:20301427-20301449 ACCAGTGGTCTGGCACTGCTGGG - Intergenic
1004914627 6:20320333-20320355 ACTCGTGGGCCAGCACTGCTGGG - Intergenic
1005035559 6:21552469-21552491 ACAGGTGGGCCGGCACTGCTGGG + Intergenic
1005059295 6:21761333-21761355 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1005117721 6:22356592-22356614 GCTGGCAGGCTGGCACTGCTGGG + Intergenic
1005275760 6:24215767-24215789 GCTGAGGGGGCGGCACTGCTTGG + Intronic
1005332870 6:24766121-24766143 ACTGGTGGGCCGGCACTGCTGGG + Intergenic
1005554232 6:26956772-26956794 GCCGGCGGGCCATCACTGTTGGG + Intergenic
1005596201 6:27381253-27381275 GCCGGTGGGCTAGCACTGCTGGG + Intronic
1005600860 6:27425013-27425035 ACCGGTGGGCTAGCACTGCTGGG + Intergenic
1005707434 6:28469538-28469560 ACCGGTGAGCTGGCACTGCTGGG + Intergenic
1005749919 6:28872778-28872800 GCGGGTGGGCCGGCACTGCTGGG + Intergenic
1005758884 6:28949978-28950000 GCCGGTGGGCTGGCACCTCTGGG + Intergenic
1005759815 6:28958019-28958041 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1005766329 6:29015269-29015291 GCGGGTGGGCCGGCAGCGGTAGG - Intergenic
1005976996 6:30807627-30807649 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1005978227 6:30816483-30816505 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1006005781 6:31000640-31000662 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1006008315 6:31020895-31020917 GCCAGTGGGCCGGCACTGCTGGG - Intronic
1006033646 6:31195636-31195658 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1006227055 6:32548109-32548131 GCCGGTGTGCCAGCACTGCTGGG + Intergenic
1006348479 6:33502866-33502888 GCTGGCGGGCCAGCACTGCTGGG - Intergenic
1006351089 6:33521693-33521715 GCGGGCGGCCCGGCAGTGCTGGG + Intergenic
1006352653 6:33532565-33532587 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1006434120 6:34017367-34017389 GCGGGTGGGCCAGCAGTGCAAGG + Intergenic
1006477842 6:34269201-34269223 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1006582037 6:35082835-35082857 GCAGGGAGGCCGGCCCTGCTGGG - Intronic
1006696021 6:35931445-35931467 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1006748889 6:36364417-36364439 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1008005581 6:46405952-46405974 GCCGGTGGGTTGGCACTGCTGGG + Intronic
1008038795 6:46774774-46774796 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1008254079 6:49275617-49275639 GCCAGTGGGCGGGCACTGCTGGG - Intergenic
1008270177 6:49482009-49482031 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1008270483 6:49483602-49483624 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1008284335 6:49629734-49629756 GCAGGTGGGCTGGCACTGCTGGG + Intronic
1008572535 6:52829379-52829401 ACGGGCGGGCCGGCACTGTTGGG + Intergenic
1008631120 6:53363641-53363663 GCCGGCGGGCCGGCAGTGCTGGG + Intergenic
1008771007 6:54979411-54979433 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1008844844 6:55950485-55950507 GCGGGTGGGCCAGCAGTGCTGGG - Intergenic
1009407095 6:63326639-63326661 GCTGGTGTGCTGGCACTGCTAGG + Intergenic
1009587659 6:65627717-65627739 ATCGGTGGGCTGGCACTGCTGGG - Intronic
1009685349 6:66949390-66949412 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1009739289 6:67723228-67723250 GCCAGTGGGCCGGTGCTGCTGGG - Intergenic
1009746688 6:67825575-67825597 ACCTGCGGGCTGGCACTGCTGGG - Intergenic
1009872274 6:69467377-69467399 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1010199301 6:73269059-73269081 GCCGGTGGACTGGCACTGCTGGG + Intronic
1010617396 6:78029978-78030000 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1011143702 6:84189543-84189565 GCCGGTGGGCCAGCACTGCTGGG - Intronic
1011246534 6:85326144-85326166 GCCGGTGGCCTAGCACTGCTGGG - Intergenic
1011879923 6:92011930-92011952 GCTGGTAGGCCGGCCCTGCTAGG + Intergenic
1012131299 6:95497118-95497140 ACAGGTGGGCCAGCACTGCTGGG - Intergenic
1012145028 6:95670216-95670238 ACCGGCAGGCAGGCACTGCTGGG - Intergenic
1012189333 6:96261130-96261152 GCCGGTGGGCTCGCGCTGCTGGG + Intergenic
1012598869 6:101070438-101070460 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1012760491 6:103294589-103294611 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1013025707 6:106269591-106269613 GCCGGTGGGCCGTCACTGCTGGG + Intronic
1013080237 6:106805931-106805953 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1013081474 6:106816947-106816969 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1013143556 6:107364430-107364452 GCCAGTGGGCCGGCACTGCTGGG + Intronic
1013410770 6:109881328-109881350 GCTGGTGGGCTGGCACTGCTTGG + Intergenic
1013853320 6:114541860-114541882 CCCAGTGGGCCAGCACTACTGGG + Intergenic
1013955332 6:115834785-115834807 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1013957252 6:115855370-115855392 GCTGGCAGGCCAGCACTGCTGGG - Intergenic
1014055898 6:117014930-117014952 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1014240753 6:119015499-119015521 ATCGGTGGGCTGGCACTGCTGGG - Intronic
1014280816 6:119441175-119441197 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1014507771 6:122280756-122280778 GCCAGCGGGCTGGCACTGCTGGG - Intergenic
1014586306 6:123202126-123202148 GCAGGCGGGCTGGCAGTGCTGGG - Intergenic
1014718572 6:124892148-124892170 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1014739012 6:125126032-125126054 GCCAGTGGGCCAGCACTGCTGGG - Intronic
1014788481 6:125644627-125644649 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1014921062 6:127214775-127214797 GCCGGTGGCCTGGCACTGCTGGG + Intergenic
1015572240 6:134633730-134633752 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1015600356 6:134904906-134904928 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1016067359 6:139698100-139698122 GCCGGTGGGGTGGCACTGCTGGG + Intergenic
1016069879 6:139726533-139726555 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1016092822 6:139999769-139999791 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1016104719 6:140148307-140148329 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1016217208 6:141618387-141618409 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1016482309 6:144495335-144495357 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1016858908 6:148698229-148698251 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1017298995 6:152834519-152834541 GCCGGTGGGCTGGCACTGTTGGG - Intergenic
1017325097 6:153133797-153133819 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1017537382 6:155363244-155363266 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1017581209 6:155866940-155866962 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1017839497 6:158209973-158209995 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1018064227 6:160114687-160114709 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1018109395 6:160520451-160520473 GCGGGCGGGCCGGCAGTGCTGGG + Intergenic
1018545682 6:164933473-164933495 GCAGGTGGTCTGGCACTGCTGGG - Intergenic
1018551331 6:165001812-165001834 GCTGGCGGGCCAGCACTGCTGGG + Intergenic
1018624635 6:165765471-165765493 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1018696188 6:166393537-166393559 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1019000254 6:168743970-168743992 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1019351455 7:556004-556026 CCCGGAGGGGCCGCACTGCTGGG - Intronic
1019618343 7:1977301-1977323 GCAGATGGGCCAGCAGTGCTGGG + Intronic
1019944258 7:4314123-4314145 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1019965743 7:4497115-4497137 GATGGTGGGCTGGCACTGCTGGG + Intergenic
1020163948 7:5793759-5793781 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1020375339 7:7478730-7478752 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1020662190 7:10995737-10995759 GCCGGCGGGCCAGCACTGCTGGG + Intronic
1020784426 7:12556344-12556366 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1021065753 7:16170766-16170788 ACAGGTGGGCCAGCAGTGCTGGG + Intronic
1021133881 7:16943164-16943186 GCGGGTGGGCCAGCACTGCTGGG - Intergenic
1021324134 7:19245659-19245681 GCAGGTGGGCCGGCACTGCTGGG - Intergenic
1021513799 7:21461422-21461444 GCCAGTGGGCCAGTACTGCTGGG + Intronic
1021573904 7:22090591-22090613 GCGGGCGGGCCAGCAGTGCTGGG - Intergenic
1021761264 7:23904896-23904918 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1022750445 7:33219149-33219171 GCCAGTGGTCTGGCACTGCTGGG - Intronic
1023127946 7:36973913-36973935 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1023232511 7:38049923-38049945 GCCAGTGGGCCGGCAGTGCTGGG - Intergenic
1023377999 7:39577575-39577597 GCCGGCAGGCTGGCACTGCTGGG - Intronic
1023396194 7:39754125-39754147 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1024269088 7:47628652-47628674 TCTGGTGGGCTGGCACTGCTGGG - Intergenic
1024335627 7:48203098-48203120 GCCGGTGGGCCGGCACTGCTGGG + Intronic
1024465913 7:49711428-49711450 GCTGGTCGGCCAGCACTGCTGGG - Intergenic
1024691289 7:51806010-51806032 AGCGCAGGGCCGGCACTGCTGGG - Intergenic
1024700626 7:51901080-51901102 GCCGGTGAGCCGGCACTGCTGGG + Intergenic
1024794356 7:53004107-53004129 GCCAGTGGGCCAGCACCGCTTGG - Intergenic
1024834057 7:53495196-53495218 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1026098333 7:67364709-67364731 GCGGGCGGGCCGGCAGTACTAGG + Intergenic
1026187080 7:68090599-68090621 GCTGGTGGGCCAGCACTGTTGGG + Intergenic
1026202959 7:68231206-68231228 GCCAGTGGGCCGGCACTTCTGGG - Intergenic
1026236986 7:68535286-68535308 GCCTGTGGGCCGGCACTGCTGGG + Intergenic
1026335907 7:69394002-69394024 GCCGGTGGGCTAGCACTGCTGGG - Intergenic
1026512352 7:71037769-71037791 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1026516574 7:71078164-71078186 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
1026596549 7:71738264-71738286 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1026826922 7:73588185-73588207 GCAGTTGGGTGGGCACTGCTGGG + Intergenic
1027561680 7:79739475-79739497 GCCGGTGGGCTGGCACTTCTTGG - Intergenic
1027564028 7:79768149-79768171 GCCGGTGGGCTGGCACTTCTGGG + Intergenic
1027665900 7:81042883-81042905 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1027667526 7:81057668-81057690 GTCGGTGGGCTGGCACTTCTGGG + Intergenic
1027668759 7:81071284-81071306 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1027674482 7:81141913-81141935 GCCGGTGGGCCGGCACTGCTTGG - Intergenic
1027698275 7:81437275-81437297 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1027868107 7:83673493-83673515 GCCGGTGGGCTGGTACTGCTGGG - Intergenic
1028070107 7:86440742-86440764 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1028142509 7:87288899-87288921 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1028392680 7:90334596-90334618 GCCACAGGGCCGGCACTGGTGGG - Intergenic
1028511211 7:91627578-91627600 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1028719409 7:94012053-94012075 GCCAGCAGGCCGGCACTGCTGGG + Intergenic
1028727183 7:94101067-94101089 GCAGGCGGGCTGGCAGTGCTGGG - Intergenic
1028778330 7:94705668-94705690 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1028852507 7:95552648-95552670 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1029065337 7:97843051-97843073 GCAGGCGGGCAGGCAGTGCTGGG + Intergenic
1029407098 7:100381894-100381916 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1029567519 7:101348750-101348772 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1029832365 7:103275110-103275132 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1030292704 7:107888162-107888184 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1030599971 7:111582128-111582150 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1030733489 7:113017518-113017540 CCTGGTGGGCTGGCACTGCTGGG - Intergenic
1030780423 7:113593494-113593516 GCCGGTGGGATGGCACTGCTGGG - Intergenic
1030819305 7:114077028-114077050 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1031056523 7:116998183-116998205 GCTGGCGGGCCGGCACTGCTGGG + Intronic
1031213349 7:118858883-118858905 GCGGGCGGGCTGGCAGTGCTGGG + Intergenic
1031253129 7:119413538-119413560 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1031292251 7:119951696-119951718 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1031378809 7:121060144-121060166 GCCACTGGGCTGGCACTGCTGGG - Intronic
1031409216 7:121421904-121421926 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1031902876 7:127429346-127429368 ACCGGTGGGCCGGCACTAATGGG - Intronic
1032248081 7:130230197-130230219 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1032339658 7:131058938-131058960 GCTGGCAGGCCAGCACTGCTGGG - Intergenic
1032437131 7:131909502-131909524 GCCGGCCGGCCGGCACTGCTGGG - Intergenic
1032561595 7:132898792-132898814 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1033664095 7:143424582-143424604 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1033779330 7:144650595-144650617 GTTGGCGGGCCGGCACTGCTGGG - Intronic
1033839916 7:145360822-145360844 GCTGGTGGGCCAGCACTGCTGGG + Intergenic
1034091054 7:148363983-148364005 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1034097923 7:148426583-148426605 GCCGGTGGGCCGGCTCTGCTGGG - Intergenic
1034155026 7:148949256-148949278 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1034167748 7:149038883-149038905 GCTGGTGGGCCGGCACTGCTGGG + Intergenic
1034632137 7:152539073-152539095 GCCGGTGGGCTGGCACTGCTAGG + Intergenic
1034656031 7:152730461-152730483 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1034900849 7:154907084-154907106 GCGGGCGGGCCGGTAGTGCTGGG - Intergenic
1035325423 7:158062746-158062768 GCTGGTGGGCTGGCACTGCTGGG - Intronic
1035333788 7:158113004-158113026 GCCGGGGGGCCCTCAATGCTGGG - Intronic
1035463889 7:159063324-159063346 GCCAGCAGGCCGGCACTGCTGGG + Intronic
1035683567 8:1507341-1507363 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1035999249 8:4583002-4583024 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1036441023 8:8781577-8781599 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1036645739 8:10610801-10610823 GCTGCTGGGCCGGCCCTGCTTGG + Exonic
1036710907 8:11077937-11077959 GCCGCCGGGCTGGCCCTGCTGGG + Intronic
1036928640 8:12931490-12931512 GCGGGCGGGCCGGCAGTGCTGGG + Intergenic
1036952506 8:13154383-13154405 GCCTGCGGGCCAGCAGTGCTGGG + Intronic
1037065031 8:14567014-14567036 CCCGGGGAGCCGGCACTGCTGGG - Intronic
1037241559 8:16784081-16784103 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1037263833 8:17037003-17037025 GCCCGTGGGCTGGCACTGCTGGG + Intronic
1037417567 8:18667869-18667891 GCCGGCAGGCCGGCACTGCTGGG + Intronic
1037425599 8:18751228-18751250 GCTGGTGGGCCGGCACTGCTGGG + Intronic
1037810984 8:22086729-22086751 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1037957542 8:23070971-23070993 GCCAGTGGGCCGGCACTGCTGGG + Intergenic
1037971331 8:23173986-23174008 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1037983534 8:23272291-23272313 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1038638288 8:29304428-29304450 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1038639412 8:29311640-29311662 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1038870709 8:31490041-31490063 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1039061314 8:33574078-33574100 GCCGGTGGGACAGCACTGCTGGG - Intergenic
1039069103 8:33634018-33634040 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1039284873 8:36029001-36029023 ACCAGTGGGCTGGCACTGCTGGG - Intergenic
1039637309 8:39180289-39180311 ACCCGTGGGCTGGCACTGCTGGG - Intronic
1040026555 8:42786933-42786955 GCTGGTGGGCCAGCACCACTAGG - Intronic
1040027703 8:42796778-42796800 GCCAGCGGGCCAGCACTGCTGGG - Intergenic
1040572928 8:48625541-48625563 CCTGGGGGGCCGGCACAGCTCGG + Intergenic
1040622226 8:49103196-49103218 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
1040723133 8:50350090-50350112 GCCCGTGAGCCGGCGCTGCTGGG - Intronic
1040794184 8:51271414-51271436 ACCGGCAGGCCGGCACTGCTGGG - Intergenic
1040952698 8:52953042-52953064 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1040954012 8:52961568-52961590 GCCGGCAGGCCCACACTGCTGGG - Intergenic
1040954914 8:52970033-52970055 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1041034650 8:53776084-53776106 GCCGGTGGGCTGGCACCGGTGGG + Intronic
1041918938 8:63162164-63162186 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1042948750 8:74179715-74179737 GCTGGCAAGCCGGCACTGCTGGG + Intergenic
1043073339 8:75665650-75665672 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1043110114 8:76169745-76169767 GCCAGTGGGCTGGCACTGCTCGG - Intergenic
1043129927 8:76447799-76447821 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1043346469 8:79303669-79303691 ACCAGTGGGCTGGCACTGCTGGG - Intergenic
1043352479 8:79377390-79377412 ACCAGTGGGCCGGCACTGCTGGG + Intergenic
1043435332 8:80231983-80232005 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1043621026 8:82192436-82192458 GCGGGCGGGCAGGCAGTGCTGGG + Intergenic
1043670647 8:82880863-82880885 GCTGGTGGGCCGGCTCTGCCGGG - Intergenic
1043701134 8:83290527-83290549 ACTGGTGGGCTGGCATTGCTGGG - Intergenic
1043709890 8:83403117-83403139 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1043725986 8:83611345-83611367 GCAGGCAGGCCGGCAGTGCTGGG + Intergenic
1043844907 8:85152781-85152803 GCAGGCGGGCCGGCAGTGCTGGG - Intergenic
1044075829 8:87821009-87821031 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1044441656 8:92230950-92230972 GCTGGTGGGCCAGCACTGCTGGG - Intergenic
1044633467 8:94300519-94300541 ACCAGTGGGCTGGCACTGCTGGG + Intergenic
1044862138 8:96533995-96534017 GCCGGCGGGCCAGCACTGCTGGG + Intronic
1044880658 8:96719272-96719294 GCTGGTGGGCTGGCACTTTTGGG + Intronic
1045096225 8:98800762-98800784 GCGGGAGGGCCGGCAGTGCTGGG - Intronic
1045131935 8:99163585-99163607 GCCGGTGGGCCAGCACTGTTGGG + Intronic
1045232319 8:100316960-100316982 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1045467754 8:102485698-102485720 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1045933740 8:107655780-107655802 GCGGGTGGGCCGGCAGTGCTGGG - Intergenic
1046149341 8:110202756-110202778 GACGGTGAGCCGGCACTGCTGGG + Intergenic
1046208881 8:111041023-111041045 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1046251889 8:111643001-111643023 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
1046260312 8:111758941-111758963 GCAGGTAGGCCAGCAGTGCTGGG + Intergenic
1046265384 8:111823476-111823498 ACCGGTGGGCTGGCACTGCTGGG + Intergenic
1046288914 8:112132866-112132888 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1046445346 8:114311525-114311547 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1046450721 8:114386331-114386353 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1047124747 8:121948212-121948234 GCCAGTGGGCCGGCACTGCTGGG - Intergenic
1047631694 8:126714822-126714844 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1048676954 8:136793986-136794008 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1048757490 8:137755306-137755328 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1048789184 8:138084310-138084332 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1049087629 8:140490700-140490722 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1049097263 8:140556361-140556383 GCTGGTGGCCTGGCTCTGCTTGG + Intronic
1049500322 8:142959651-142959673 GCTGGGGGGCCAGCACTGCTGGG - Intergenic
1049781762 8:144432372-144432394 GCCGGCGGGCAGGCTCTGCAGGG + Exonic
1050294921 9:4195472-4195494 GCTGGCGGGCCGGCAGTGCTGGG - Intronic
1050892013 9:10836130-10836152 ACCAGCAGGCCGGCACTGCTGGG - Intergenic
1050920622 9:11197040-11197062 GCCGGTGGGCCAGCACTTCTGGG - Intergenic
1051305080 9:15700227-15700249 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1051314185 9:15810589-15810611 GCGGGCGGGCCGGCAGTGCTGGG + Intronic
1051383312 9:16480682-16480704 GCCAGTGGGCTGGCACTGCTGGG - Intronic
1051459423 9:17295019-17295041 GCCGGTGGGCCAACACTGCTGGG + Intronic
1051549770 9:18315529-18315551 ATGGGTGGGCCGGCAGTGCTGGG + Intergenic
1051867360 9:21696640-21696662 GCCGGTGGGCGGGGACTGAGGGG - Intergenic
1051892702 9:21959425-21959447 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1052014855 9:23452208-23452230 GCGGGCGGGCCGACACTGCTGGG - Intergenic
1052075456 9:24135243-24135265 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1052111799 9:24594800-24594822 GCCCGTGGCCGGGCTCTGCTTGG - Intergenic
1052576583 9:30299440-30299462 CCCAGCAGGCCGGCACTGCTGGG - Intergenic
1052985340 9:34482950-34482972 GCTGGTGGGCCAGCACTGCTGGG + Intronic
1053027277 9:34740422-34740444 GCCGGTGGGCGGGCACTGCTGGG + Intergenic
1053393420 9:37752052-37752074 GCCGGTGGGCCGGCCCTGCTGGG - Intronic
1053547907 9:39042543-39042565 ACTGGTGGGCCGGCACTGCTGGG + Intergenic
1053812029 9:41862584-41862606 ACCGGTGGGCCGGCACTGCTGGG + Intergenic
1054618566 9:67324855-67324877 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1054722457 9:68617198-68617220 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1055049367 9:71963713-71963735 GCCAGTGGGCTGGCACTGCTGGG - Intronic
1055248583 9:74276117-74276139 ACAAGTGGGCCCGCACTGCTGGG + Intergenic
1055557571 9:77490569-77490591 GCGGGTGGGCTGGCACTGCTGGG + Intronic
1055651384 9:78410171-78410193 GCCTGTGAGCCGGCACTGCTGGG - Intergenic
1055654941 9:78442248-78442270 ACCAGTGGGCCGGCACTGCTGGG - Intergenic
1055814158 9:80185482-80185504 GCAGGTGGGCCGGCACTGCTGGG + Intergenic
1055985507 9:82054520-82054542 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1056080956 9:83093483-83093505 CCCGGTGGGCTGGCACTGCTGGG + Intergenic
1056216282 9:84408652-84408674 GCTGCTGGGACGGCCCTGCTGGG - Intergenic
1056305772 9:85289220-85289242 GCTGGCGGGCCGGCACTGCTGGG - Intergenic
1056677237 9:88686101-88686123 GCTGGCAGGCCAGCACTGCTAGG + Intergenic
1056743754 9:89282599-89282621 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1056771387 9:89480604-89480626 GCCGGTGGGCCAGCACTGCTGGG + Intronic
1056799448 9:89681265-89681287 ACAGGTGGGCCAGCACTGCTGGG - Intergenic
1056914032 9:90729646-90729668 GCCGGTGGGCCAGCACTGTTGGG - Intergenic
1057118171 9:92545423-92545445 GCCGGTGGGCCGGCACTGCTGGG - Intronic
1057383913 9:94591330-94591352 GCCAGTGGGCCAGCACTGCTGGG + Intronic
1057403147 9:94742347-94742369 GCCTGTGGGTAGGCACTGGTTGG - Intronic
1057511143 9:95680505-95680527 GCCAGTGGACTGGCACTGCTAGG - Intergenic
1057543853 9:96001905-96001927 ACCAGTGGGCCAGCACTGCTGGG + Intronic
1057628626 9:96701074-96701096 GCCAGTGGGCCAGCACTGCTGGG + Intergenic
1058174860 9:101724301-101724323 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1058286571 9:103187077-103187099 ACCGGTGGGCCGGCACTGCTGGG - Intergenic
1058365192 9:104200769-104200791 GCCAGTGAGCCAGCACTGCTGGG - Intergenic
1058379562 9:104363086-104363108 TCCAGTGGGCCTGCACTGCTGGG + Intergenic
1058786504 9:108393688-108393710 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1058799373 9:108530319-108530341 GTCGGTGGGCCGGCACTGCTGGG - Intergenic
1059810628 9:117852200-117852222 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1060594226 9:124838920-124838942 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1060831881 9:126722544-126722566 GGCGGTGGGAGGGGACTGCTGGG - Intergenic
1061483834 9:130910296-130910318 GCCGGTGGGCTGGCACTGCTGGG - Intronic
1061968164 9:134027768-134027790 GCCAGTGGGCCGCAAATGCTTGG - Intergenic
1062099389 9:134720295-134720317 GCTGGTGGGCAGCCCCTGCTTGG - Intronic
1062146206 9:134991218-134991240 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1062214534 9:135382140-135382162 GCTGGCGGGCAGGCTCTGCTGGG + Intergenic
1062412955 9:136433998-136434020 GCCCCTGGGCAGGCACTGCAGGG + Intronic
1062584787 9:137244367-137244389 GCCGGAGGGCCGGCACTCCGTGG + Intronic
1186152587 X:6690693-6690715 ACCAGTGGGCTGGCACTGCTGGG + Intergenic
1186282072 X:8003461-8003483 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1186323246 X:8452677-8452699 ACTGGTGGGCTGGCACTGCTGGG + Intergenic
1187005834 X:15231917-15231939 GCCTGTGGGCTGTCACTGCTGGG + Intergenic
1187139056 X:16575627-16575649 GCTGGTGGGCCGGCACTGCTGGG - Intergenic
1187304615 X:18083977-18083999 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1187557567 X:20367036-20367058 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1187904021 X:24049866-24049888 GCCGGCGGGCTGGCACTGCTGGG - Intergenic
1188189536 X:27157178-27157200 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1189298573 X:39936086-39936108 GCCGGTGGCCCAGCACTGGCAGG + Intergenic
1189467110 X:41285895-41285917 CAAGGTGGGCCGGCACTGCTGGG + Intergenic
1190045864 X:47111190-47111212 ACTGGTTGGCTGGCACTGCTGGG + Intergenic
1190413958 X:50163517-50163539 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1191618627 X:63192758-63192780 GCCCGTGGGCCGGCACTGCTGGG + Intergenic
1192869653 X:75173784-75173806 GCTGGTGGGCTGGCACTCCTGGG + Intergenic
1192870561 X:75179704-75179726 GCTGGTGGGCTGGCACTGCTGGG + Intergenic
1193040197 X:76996845-76996867 TCCAGTGGGCTGGCACTGCTGGG + Intergenic
1193271076 X:79530754-79530776 CACCGTGGGCCAGCACTGCTGGG - Intergenic
1193538152 X:82738390-82738412 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1193719985 X:84975053-84975075 GCAGGCGGGCCGGCAGTGCTGGG - Intergenic
1193804035 X:85972544-85972566 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1194071593 X:89331216-89331238 ACTGGTGGGCCAGCACTGCTGGG + Intergenic
1194121200 X:89965833-89965855 GCCGGTGGGCTGGCACTGCTAGG + Intergenic
1194166352 X:90521509-90521531 GCCGGTGGGCCAGCACTGCTGGG - Intergenic
1194204473 X:90995580-90995602 GCGGGTGGGCCAGCAGTGCTGGG - Intergenic
1194340447 X:92699668-92699690 GTGGATGGGCCGGCAGTGCTGGG + Intergenic
1194384389 X:93235905-93235927 GCCAGGGGGCCTGCACTGCTGGG - Intergenic
1194650817 X:96512438-96512460 GCCGGTGGGCCAGCACTGCTGGG + Intergenic
1195258029 X:103107536-103107558 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1195942713 X:110178936-110178958 TCCAGTGTGCTGGCACTGCTGGG + Intronic
1196319527 X:114270747-114270769 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1196582700 X:117394855-117394877 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1196662523 X:118282928-118282950 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1196705905 X:118717123-118717145 GCCCGTGGGCTGGCACTGCTGGG + Intergenic
1196714620 X:118799130-118799152 GCCGGTGGGCCGGCACTGCTGGG - Intergenic
1196728925 X:118922170-118922192 GCCGGTGGGCCCGCACTGCTGGG + Intergenic
1196741525 X:119029688-119029710 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1196761966 X:119208659-119208681 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1196762340 X:119211066-119211088 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1196775207 X:119332048-119332070 GCCGGTCGGCTGGCACTGGTGGG - Intergenic
1196775517 X:119333769-119333791 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1196781459 X:119387771-119387793 GCCAGTGGGCTGGCACTGCTGGG + Intergenic
1196793974 X:119488050-119488072 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1196827267 X:119751008-119751030 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1196845067 X:119890765-119890787 GCCGGTGGGCCGGCATTGCTGGG - Intergenic
1196860855 X:120025972-120025994 GCCGGCGGGCCGGCGCTGCTAGG + Intergenic
1197000284 X:121431715-121431737 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1197331176 X:125155663-125155685 ACCGGTGGGCCGGCACTGTGGGG + Intergenic
1197340056 X:125255821-125255843 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1197344822 X:125319249-125319271 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1197376793 X:125690766-125690788 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1197607934 X:128606779-128606801 CGCGGTGGGCCGGCACCGCTGGG - Intergenic
1197978762 X:132194260-132194282 ACCGGTGGGCCAGCACTGCTGGG - Intergenic
1198060923 X:133044551-133044573 GCCAGTGGGCCGGCACTGCTGGG - Intronic
1198256140 X:134925818-134925840 GCTGGTGGGCAGGCACTGCTGGG - Intergenic
1198299992 X:135325628-135325650 GCCGGTGGGCTGGCGCTGCTGGG - Intronic
1198664305 X:139004212-139004234 GCCGGTGGGCTGGCACTGCTGGG + Intronic
1198694454 X:139320976-139320998 GCCAGTGGGCCAGCACTGCTGGG - Intergenic
1198872305 X:141188725-141188747 ACCAGTGGGCCGGCACTGCTGGG + Intergenic
1198972586 X:142298432-142298454 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1199009937 X:142745910-142745932 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1199028793 X:142972323-142972345 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1199050223 X:143228877-143228899 GCCGGTGGGCTGGCACTGCTAGG + Intergenic
1199175542 X:144783792-144783814 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1199356242 X:146867069-146867091 CCCGGTGGGCTGGCACTGCTGGG + Intergenic
1199831277 X:151551374-151551396 GCCGGTGGGCCGGCACTGCTGGG + Intergenic
1200423557 Y:2998562-2998584 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1200470899 Y:3584284-3584306 CCCGGTGGGCCGGCACTGCTGGG + Intergenic
1200474057 Y:3623284-3623306 GCCGGTGGGCTGGCACTGCTGGG + Intergenic
1200512620 Y:4099290-4099312 GCCGGTGGGCTGGCACTGCTGGG - Intergenic
1200550313 Y:4571021-4571043 GCGGGTGGGCCAGCAGTGCTGGG - Intergenic
1200648806 Y:5816404-5816426 GTGGATGGGCCGGCAGTGCTGGG + Intergenic
1200725831 Y:6666945-6666967 ACTGGTGGGCCAGCACTGCTGGG + Intergenic
1200824291 Y:7622403-7622425 GCCGGTGGGCCAGCCCGGCTGGG + Intergenic
1200888682 Y:8298791-8298813 GCTGGTGGGCTGGCACTGCTGGG - Intergenic
1200955324 Y:8938507-8938529 GCAGGTGGGGCAGCAGTGCTGGG - Intergenic
1201285475 Y:12375196-12375218 ACCGGTTGGCTGGCACTGCTGGG + Intergenic
1201423037 Y:13820392-13820414 GTGGGTGGGCTGGCACTGCTGGG + Intergenic
1201479940 Y:14428264-14428286 GCAGGTGGGCCGGCACTTCTGGG - Intergenic
1201487073 Y:14505824-14505846 ACTGGTGGGCTGGCACTGCTGGG - Intergenic
1201488165 Y:14512988-14513010 ACCGGTGGGCTGGCACTGCTGGG - Intergenic
1201495685 Y:14589970-14589992 GCCAGTGGGCCAGCACTGCTGGG + Intronic
1201496930 Y:14598383-14598405 GCCGGTGGGCCAGCGCTGCTGGG + Intronic
1201499575 Y:14627480-14627502 GCGGGCGGGCCGGCAGTGCTGGG + Intronic
1201573039 Y:15434018-15434040 GCCAGTGGGCTGGCACTGCTGGG - Intergenic
1201729017 Y:17185786-17185808 GCAGGTGGGCCAGCTGTGCTGGG + Intergenic
1201901106 Y:19046753-19046775 GCGGATGGGCCAGCGCTGCTGGG + Intergenic
1202137090 Y:21676850-21676872 GCCCGTGGGCTGGCACTGCTGGG + Intergenic
1202202420 Y:22367344-22367366 GCTGGTTGGCTGGCACTGCTGGG + Intronic
1202235764 Y:22708684-22708706 GCCGGTGAGCCAGCCCGGCTGGG - Intergenic
1202271489 Y:23078526-23078548 GCTGGTGGGTCAGCACTGCTGGG + Intergenic
1202294537 Y:23342156-23342178 GCTGGTGGGTCAGCACTGCTGGG - Intergenic
1202307399 Y:23487484-23487506 GCCGGTGAGCCAGCCCGGCTGGG + Intergenic
1202424484 Y:24712270-24712292 GCTGGTGGGTCAGCACTGCTGGG + Intergenic
1202446305 Y:24957815-24957837 GCTGGTGGGTCAGCACTGCTGGG - Intergenic
1202563406 Y:26183102-26183124 GCCGGTGAGCCAGCCCGGCTGGG - Intergenic