ID: 985145444

View in Genome Browser
Species Human (GRCh38)
Location 4:186890302-186890324
Sequence AAATCCAGCACAGAGCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145444_985145448 6 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145444_985145451 11 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145444_985145454 17 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145444_985145452 12 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145452 4:186890337-186890359 TAGCTGCCTCCCCTCGGGCAGGG No data
985145444_985145456 18 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145444_985145449 7 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145444_985145453 16 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145444 Original CRISPR AAATCCAGCACAGAGCCGGT GGG (reversed) Intergenic
No off target data available for this crispr