ID: 985145445

View in Genome Browser
Species Human (GRCh38)
Location 4:186890303-186890325
Sequence GAAATCCAGCACAGAGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145445_985145451 10 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145445_985145452 11 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145452 4:186890337-186890359 TAGCTGCCTCCCCTCGGGCAGGG No data
985145445_985145448 5 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145445_985145456 17 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145445_985145453 15 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145445_985145454 16 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145445_985145449 6 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145445 Original CRISPR GAAATCCAGCACAGAGCCGG TGG (reversed) Intergenic