ID: 985145446

View in Genome Browser
Species Human (GRCh38)
Location 4:186890306-186890328
Sequence CAAGAAATCCAGCACAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145446_985145448 2 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145446_985145452 8 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145452 4:186890337-186890359 TAGCTGCCTCCCCTCGGGCAGGG No data
985145446_985145453 12 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145446_985145454 13 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145446_985145451 7 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145446_985145449 3 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145446_985145456 14 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145446 Original CRISPR CAAGAAATCCAGCACAGAGC CGG (reversed) Intergenic