ID: 985145447

View in Genome Browser
Species Human (GRCh38)
Location 4:186890329-186890351
Sequence GAGGGGAGGCAGCTAAGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145447_985145454 -10 Left 985145447 4:186890329-186890351 CCGTGCCTTAGCTGCCTCCCCTC No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145447_985145456 -9 Left 985145447 4:186890329-186890351 CCGTGCCTTAGCTGCCTCCCCTC No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145447 Original CRISPR GAGGGGAGGCAGCTAAGGCA CGG (reversed) Intergenic
No off target data available for this crispr