ID: 985145448

View in Genome Browser
Species Human (GRCh38)
Location 4:186890331-186890353
Sequence GTGCCTTAGCTGCCTCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145445_985145448 5 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145444_985145448 6 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145442_985145448 10 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145436_985145448 28 Left 985145436 4:186890280-186890302 CCGGGTCCCCCAGCAGTGCCGGC 0: 71
1: 163
2: 175
3: 134
4: 334
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145438_985145448 21 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG 0: 148
1: 527
2: 450
3: 241
4: 291
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145446_985145448 2 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145437_985145448 22 Left 985145437 4:186890286-186890308 CCCCCAGCAGTGCCGGCCCACCG 0: 147
1: 507
2: 443
3: 235
4: 315
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145441_985145448 19 Left 985145441 4:186890289-186890311 CCAGCAGTGCCGGCCCACCGGCT No data
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data
985145440_985145448 20 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145448 4:186890331-186890353 GTGCCTTAGCTGCCTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145448 Original CRISPR GTGCCTTAGCTGCCTCCCCT CGG Intergenic
No off target data available for this crispr