ID: 985145449

View in Genome Browser
Species Human (GRCh38)
Location 4:186890332-186890354
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145437_985145449 23 Left 985145437 4:186890286-186890308 CCCCCAGCAGTGCCGGCCCACCG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145441_985145449 20 Left 985145441 4:186890289-186890311 CCAGCAGTGCCGGCCCACCGGCT No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145436_985145449 29 Left 985145436 4:186890280-186890302 CCGGGTCCCCCAGCAGTGCCGGC No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145440_985145449 21 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145442_985145449 11 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145438_985145449 22 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145445_985145449 6 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145446_985145449 3 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data
985145444_985145449 7 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145449 4:186890332-186890354 TGCCTTAGCTGCCTCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type