ID: 985145451

View in Genome Browser
Species Human (GRCh38)
Location 4:186890336-186890358
Sequence TTAGCTGCCTCCCCTCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145440_985145451 25 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145438_985145451 26 Left 985145438 4:186890287-186890309 CCCCAGCAGTGCCGGCCCACCGG 0: 148
1: 527
2: 450
3: 241
4: 291
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145441_985145451 24 Left 985145441 4:186890289-186890311 CCAGCAGTGCCGGCCCACCGGCT No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145437_985145451 27 Left 985145437 4:186890286-186890308 CCCCCAGCAGTGCCGGCCCACCG 0: 147
1: 507
2: 443
3: 235
4: 315
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145445_985145451 10 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145444_985145451 11 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145446_985145451 7 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data
985145442_985145451 15 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145451 4:186890336-186890358 TTAGCTGCCTCCCCTCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145451 Original CRISPR TTAGCTGCCTCCCCTCGGGC AGG Intergenic
No off target data available for this crispr