ID: 985145453

View in Genome Browser
Species Human (GRCh38)
Location 4:186890341-186890363
Sequence TGCCTCCCCTCGGGCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145442_985145453 20 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145445_985145453 15 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145444_985145453 16 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145441_985145453 29 Left 985145441 4:186890289-186890311 CCAGCAGTGCCGGCCCACCGGCT No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145446_985145453 12 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data
985145440_985145453 30 Left 985145440 4:186890288-186890310 CCCAGCAGTGCCGGCCCACCGGC 0: 121
1: 490
2: 425
3: 286
4: 254
Right 985145453 4:186890341-186890363 TGCCTCCCCTCGGGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145453 Original CRISPR TGCCTCCCCTCGGGCAGGGC TGG Intergenic
No off target data available for this crispr