ID: 985145454

View in Genome Browser
Species Human (GRCh38)
Location 4:186890342-186890364
Sequence GCCTCCCCTCGGGCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145446_985145454 13 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145444_985145454 17 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145445_985145454 16 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145447_985145454 -10 Left 985145447 4:186890329-186890351 CCGTGCCTTAGCTGCCTCCCCTC No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145441_985145454 30 Left 985145441 4:186890289-186890311 CCAGCAGTGCCGGCCCACCGGCT No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data
985145442_985145454 21 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145454 4:186890342-186890364 GCCTCCCCTCGGGCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985145454 Original CRISPR GCCTCCCCTCGGGCAGGGCT GGG Intergenic
No off target data available for this crispr