ID: 985145456

View in Genome Browser
Species Human (GRCh38)
Location 4:186890343-186890365
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985145444_985145456 18 Left 985145444 4:186890302-186890324 CCCACCGGCTCTGTGCTGGATTT No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145442_985145456 22 Left 985145442 4:186890298-186890320 CCGGCCCACCGGCTCTGTGCTGG No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145446_985145456 14 Left 985145446 4:186890306-186890328 CCGGCTCTGTGCTGGATTTCTTG No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145445_985145456 17 Left 985145445 4:186890303-186890325 CCACCGGCTCTGTGCTGGATTTC No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data
985145447_985145456 -9 Left 985145447 4:186890329-186890351 CCGTGCCTTAGCTGCCTCCCCTC No data
Right 985145456 4:186890343-186890365 CCTCCCCTCGGGCAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type