ID: 985149572

View in Genome Browser
Species Human (GRCh38)
Location 4:186932615-186932637
Sequence ATGTGTCTAAAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985149572_985149575 -10 Left 985149572 4:186932615-186932637 CCTTCCTCCATTTTTAGACACAT No data
Right 985149575 4:186932628-186932650 TTAGACACATGACTCTATTAAGG No data
985149572_985149576 -9 Left 985149572 4:186932615-186932637 CCTTCCTCCATTTTTAGACACAT No data
Right 985149576 4:186932629-186932651 TAGACACATGACTCTATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985149572 Original CRISPR ATGTGTCTAAAAATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr