ID: 985150271

View in Genome Browser
Species Human (GRCh38)
Location 4:186939965-186939987
Sequence CAAAAGATTCAGGTTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985150271_985150274 -9 Left 985150271 4:186939965-186939987 CCTTGGGAAACCTGAATCTTTTG No data
Right 985150274 4:186939979-186940001 AATCTTTTGTAATTGGCACTTGG No data
985150271_985150275 11 Left 985150271 4:186939965-186939987 CCTTGGGAAACCTGAATCTTTTG No data
Right 985150275 4:186939999-186940021 TGGCATGCTTGCTATTTGCTAGG No data
985150271_985150276 15 Left 985150271 4:186939965-186939987 CCTTGGGAAACCTGAATCTTTTG No data
Right 985150276 4:186940003-186940025 ATGCTTGCTATTTGCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985150271 Original CRISPR CAAAAGATTCAGGTTTCCCA AGG (reversed) Intergenic