ID: 985150909

View in Genome Browser
Species Human (GRCh38)
Location 4:186946169-186946191
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985150909_985150911 9 Left 985150909 4:186946169-186946191 CCAGCAGAGCAGCATCAGAGAAA No data
Right 985150911 4:186946201-186946223 TTTCAAAAGAAAGAGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985150909 Original CRISPR TTTCTCTGATGCTGCTCTGC TGG (reversed) Intergenic