ID: 985150911 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:186946201-186946223 |
| Sequence | TTTCAAAAGAAAGAGTCAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985150909_985150911 | 9 | Left | 985150909 | 4:186946169-186946191 | CCAGCAGAGCAGCATCAGAGAAA | No data | ||
| Right | 985150911 | 4:186946201-186946223 | TTTCAAAAGAAAGAGTCAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985150911 | Original CRISPR | TTTCAAAAGAAAGAGTCAAA TGG | Intergenic | ||