ID: 985151184

View in Genome Browser
Species Human (GRCh38)
Location 4:186948597-186948619
Sequence CAGTCTACAGACTGTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985151182_985151184 -9 Left 985151182 4:186948583-186948605 CCAGGCTAAATATACAGTCTACA No data
Right 985151184 4:186948597-186948619 CAGTCTACAGACTGTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985151184 Original CRISPR CAGTCTACAGACTGTGTTGG TGG Intergenic
No off target data available for this crispr