ID: 985151531

View in Genome Browser
Species Human (GRCh38)
Location 4:186952144-186952166
Sequence GCATTGTTAAGAAGCACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985151525_985151531 21 Left 985151525 4:186952100-186952122 CCTGGAGAGGTTCTAAATGTAGG No data
Right 985151531 4:186952144-186952166 GCATTGTTAAGAAGCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985151531 Original CRISPR GCATTGTTAAGAAGCACCTC AGG Intergenic
No off target data available for this crispr