ID: 985153965

View in Genome Browser
Species Human (GRCh38)
Location 4:186969385-186969407
Sequence GGCAGGCGACATGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985153956_985153965 5 Left 985153956 4:186969357-186969379 CCCCGGACGCCACCATTTCACAT No data
Right 985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG No data
985153962_985153965 -7 Left 985153962 4:186969369-186969391 CCATTTCACATGAAGAGGCAGGC No data
Right 985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG No data
985153958_985153965 3 Left 985153958 4:186969359-186969381 CCGGACGCCACCATTTCACATGA No data
Right 985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG No data
985153957_985153965 4 Left 985153957 4:186969358-186969380 CCCGGACGCCACCATTTCACATG No data
Right 985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG No data
985153960_985153965 -4 Left 985153960 4:186969366-186969388 CCACCATTTCACATGAAGAGGCA No data
Right 985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985153965 Original CRISPR GGCAGGCGACATGGGAGTGC TGG Intergenic
No off target data available for this crispr