ID: 985159393

View in Genome Browser
Species Human (GRCh38)
Location 4:187028561-187028583
Sequence TGGCACCATCGCTGAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985159393_985159395 -4 Left 985159393 4:187028561-187028583 CCTGGAGCTCAGCGATGGTGCCA No data
Right 985159395 4:187028580-187028602 GCCAGAGGATTCCTCCTCCAAGG No data
985159393_985159400 17 Left 985159393 4:187028561-187028583 CCTGGAGCTCAGCGATGGTGCCA No data
Right 985159400 4:187028601-187028623 GGTCAACGATGATACAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985159393 Original CRISPR TGGCACCATCGCTGAGCTCC AGG (reversed) Intergenic
No off target data available for this crispr