ID: 985162643

View in Genome Browser
Species Human (GRCh38)
Location 4:187060656-187060678
Sequence AACTCTAGGACGTTGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985162643_985162653 20 Left 985162643 4:187060656-187060678 CCTGTTACCAACGTCCTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 985162653 4:187060699-187060721 GATGGCGACACAAACAGCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
985162643_985162652 17 Left 985162643 4:187060656-187060678 CCTGTTACCAACGTCCTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 985162652 4:187060696-187060718 GAGGATGGCGACACAAACAGCGG 0: 1
1: 0
2: 0
3: 9
4: 158
985162643_985162648 2 Left 985162643 4:187060656-187060678 CCTGTTACCAACGTCCTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 985162648 4:187060681-187060703 CTCTGCTGCCCCAGCGAGGATGG 0: 1
1: 1
2: 2
3: 25
4: 255
985162643_985162654 29 Left 985162643 4:187060656-187060678 CCTGTTACCAACGTCCTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 985162654 4:187060708-187060730 ACAAACAGCGGTGGTGTCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 141
985162643_985162646 -2 Left 985162643 4:187060656-187060678 CCTGTTACCAACGTCCTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 985162646 4:187060677-187060699 TTGCCTCTGCTGCCCCAGCGAGG 0: 1
1: 0
2: 1
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985162643 Original CRISPR AACTCTAGGACGTTGGTAAC AGG (reversed) Intergenic
906074127 1:43039440-43039462 GACACTTGGACTTTGGTAACAGG - Intergenic
909496791 1:76287928-76287950 AACTCTAGGACCTTGGACAAAGG - Intronic
910167134 1:84339486-84339508 AACTCTAGGGGGTTGGTACCGGG + Intronic
1071710077 10:88041460-88041482 AACTCTAGGATGGTGGTGAGAGG + Intergenic
1084022993 11:66429279-66429301 AAGTGTAAGATGTTGGTAACAGG + Intergenic
1090531893 11:127599773-127599795 AACTCTAGGATTATGGTAACTGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1108839465 13:54593904-54593926 AACTCTGGAAGGTTGGTATCAGG - Intergenic
1109105103 13:58240213-58240235 AACTCTGGAAGGTTGGTACCAGG - Intergenic
1112225961 13:97540530-97540552 AATTCTAGGAAGTGGGAAACCGG - Intergenic
1114032797 14:18590547-18590569 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1114077588 14:19169591-19169613 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1114084579 14:19229992-19230014 AACTCTAGGATGTGGGTGCCTGG + Intergenic
1117056077 14:51913114-51913136 AACTCTAGGTGGTTGGTAAGTGG + Intronic
1117220502 14:53599852-53599874 AAAGATAGGACTTTGGTAACAGG - Intergenic
1202896175 14_GL000194v1_random:11824-11846 AACTCTAGGATGTGGGTGCCTGG + Intergenic
1152927897 17:83095961-83095983 TTCTCTAGGACATTGGTCACTGG + Intergenic
1156001799 18:32393399-32393421 AACTTTAGGAGGTAGGTAAAAGG + Intronic
1158796528 18:60852874-60852896 AACTCTAGTCCATTGGTCACTGG - Intergenic
1163735394 19:18977185-18977207 CACTCTAGCAGGTTGGAAACAGG - Intergenic
926751218 2:16200138-16200160 AACTCCACCACGTTGGGAACTGG + Intergenic
937352025 2:121172026-121172048 AACTCTATGATAATGGTAACAGG + Intergenic
938505300 2:131874052-131874074 AATTCTAGGAGGATGGTTACAGG + Intergenic
939618390 2:144386870-144386892 AACTCTAGGCTGTGGATAACAGG + Intergenic
943152963 2:184137951-184137973 AACTCTGGGACACTGGTATCAGG + Intergenic
943710109 2:191083328-191083350 TACTCAAGGACTTTGGGAACTGG + Intronic
945527454 2:210905766-210905788 ATCTTTAGGATGTTTGTAACTGG - Intergenic
1171749329 20:29032672-29032694 AACTCTAAGACCTTGGTTATTGG + Intergenic
1176315848 21:5243016-5243038 AACTCTAAGACCTTGGTTATTGG - Intergenic
1176615855 21:9027807-9027829 AACTCTAGGATGTGGGTGCCTGG + Intergenic
1176709307 21:10135927-10135949 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1180293390 22:10863209-10863231 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1180393646 22:12308961-12308983 AACTCTAAGACCTTGGTTATTGG - Intergenic
1180406103 22:12555791-12555813 AACTCTAAGACCTTGGTTATTGG + Intergenic
1180456912 22:15517603-15517625 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1180496196 22:15892625-15892647 AACTCTAGGATGTGGGTGCCTGG - Intergenic
949868235 3:8564523-8564545 AATTCTAGCACGTTGGGAACTGG - Intronic
964486213 3:157187237-157187259 AACTCTAGGGGGCTGGTATCGGG - Intergenic
976032564 4:80773903-80773925 TACTCTAGCAAGTTGCTAACTGG + Intronic
979096046 4:116552949-116552971 AACTCTAGGGGGCTGGTATCAGG + Intergenic
979313144 4:119228109-119228131 AAGTCTAGGTCGTTTTTAACTGG + Intronic
980834328 4:138172792-138172814 AACTCTATGACCTTGGTTTCTGG + Intronic
982463180 4:155696761-155696783 AATTCAAGGACACTGGTAACTGG - Exonic
985162643 4:187060656-187060678 AACTCTAGGACGTTGGTAACAGG - Intergenic
990083108 5:51941083-51941105 AACTCTAGGTAGCTGGTACCAGG + Intergenic
990352684 5:54934644-54934666 AAATCTTGGATGTGGGTAACTGG + Intergenic
992994123 5:82315859-82315881 AACTCGAGTACTTGGGTAACTGG + Intronic
1013730996 6:113167098-113167120 AAGTTTAAGATGTTGGTAACTGG - Intergenic
1019212319 6:170416734-170416756 AACTCTCGAACTTTAGTAACAGG - Intergenic
1021717828 7:23474832-23474854 AACTCTAAGATGTTGGAAATGGG - Intergenic
1030539317 7:110809999-110810021 AACTCTAAGAGGTTGGTGGCTGG + Intronic
1031344976 7:120653425-120653447 AACTCTGGGACTTTGATAAACGG + Intronic
1042670109 8:71252659-71252681 AACTCTAGGAAGCTGGCAAAAGG + Intronic
1042752138 8:72170016-72170038 AACTCTAGGGAGCTGGTACCAGG + Intergenic
1046061880 8:109150033-109150055 AACAATAGGACGTCTGTAACAGG + Intergenic
1048848802 8:138624563-138624585 TACTCTAGAACTTTGATAACGGG + Intronic
1053505713 9:38641719-38641741 AGCTCTAGGAGGTGGGTCACAGG - Intergenic
1053646274 9:40121463-40121485 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1053720436 9:40940576-40940598 AACTCTAAGACCTTGGTTATTGG + Intergenic
1053759441 9:41342088-41342110 AACTCTAGGATGTGGGTGCCTGG + Intergenic
1054327285 9:63719365-63719387 AACTCTAGGATGTGGGTGCCCGG - Intergenic
1054345547 9:63911555-63911577 AACTCTAAGACCTTGGTTATTGG - Intergenic
1054538295 9:66254510-66254532 AACTCTAGGATGTGGGTGCCTGG + Intergenic
1062411093 9:136424920-136424942 AACACTAGGATGTTTCTAACAGG - Intergenic
1202794068 9_KI270719v1_random:104894-104916 AACTCTAGGATGTGGGTGCCTGG - Intergenic
1203454702 Un_GL000219v1:155292-155314 AACTCTAAGACCTTGGTTATTGG - Intergenic
1186378303 X:9032665-9032687 AACTGTAGTACGTTGTTTACTGG - Intronic
1189398175 X:40642205-40642227 GACTCTAGAAAGTTGGTAATGGG + Intronic
1190856109 X:54296550-54296572 AAGTCTAGGAAGATGGTAATGGG + Intronic
1195939743 X:110158237-110158259 AGCTCTAGAAGGTTGGTGACTGG + Intronic
1197698468 X:129576529-129576551 AAGTCTATGAGTTTGGTAACAGG - Exonic
1201149248 Y:11086531-11086553 AACTCTAGGATGTGGGTGCCTGG + Intergenic