ID: 985168615

View in Genome Browser
Species Human (GRCh38)
Location 4:187124478-187124500
Sequence TTCTGTGTGCAGGAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985168615_985168620 -6 Left 985168615 4:187124478-187124500 CCGTCCACCTCCTGCACACAGAA No data
Right 985168620 4:187124495-187124517 ACAGAAGTCTCAGCTGGAAGTGG No data
985168615_985168621 -3 Left 985168615 4:187124478-187124500 CCGTCCACCTCCTGCACACAGAA No data
Right 985168621 4:187124498-187124520 GAAGTCTCAGCTGGAAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985168615 Original CRISPR TTCTGTGTGCAGGAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr