ID: 985172499

View in Genome Browser
Species Human (GRCh38)
Location 4:187167073-187167095
Sequence AAATTGAGACTATACAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985172499_985172501 -3 Left 985172499 4:187167073-187167095 CCATGCCTGTATAGTCTCAATTT No data
Right 985172501 4:187167093-187167115 TTTGCATTTGCACCTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985172499 Original CRISPR AAATTGAGACTATACAGGCA TGG (reversed) Intergenic
No off target data available for this crispr