ID: 985173958

View in Genome Browser
Species Human (GRCh38)
Location 4:187181333-187181355
Sequence GCCGTGGATCTCCCTTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985173958_985173960 8 Left 985173958 4:187181333-187181355 CCAGGTGAAGGGAGATCCACGGC No data
Right 985173960 4:187181364-187181386 TCTTTGACTTTCTCCACTCCTGG No data
985173958_985173961 11 Left 985173958 4:187181333-187181355 CCAGGTGAAGGGAGATCCACGGC No data
Right 985173961 4:187181367-187181389 TTGACTTTCTCCACTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985173958 Original CRISPR GCCGTGGATCTCCCTTCACC TGG (reversed) Intergenic
No off target data available for this crispr