ID: 985181909

View in Genome Browser
Species Human (GRCh38)
Location 4:187273697-187273719
Sequence ATTCTATTCACACCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985181909_985181914 18 Left 985181909 4:187273697-187273719 CCAGGATTTGGTGTGAATAGAAT No data
Right 985181914 4:187273738-187273760 ACACACAATCCAGTATTAAAGGG No data
985181909_985181913 17 Left 985181909 4:187273697-187273719 CCAGGATTTGGTGTGAATAGAAT No data
Right 985181913 4:187273737-187273759 CACACACAATCCAGTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985181909 Original CRISPR ATTCTATTCACACCAAATCC TGG (reversed) Intergenic
No off target data available for this crispr