ID: 985181914

View in Genome Browser
Species Human (GRCh38)
Location 4:187273738-187273760
Sequence ACACACAATCCAGTATTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985181909_985181914 18 Left 985181909 4:187273697-187273719 CCAGGATTTGGTGTGAATAGAAT No data
Right 985181914 4:187273738-187273760 ACACACAATCCAGTATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985181914 Original CRISPR ACACACAATCCAGTATTAAA GGG Intergenic
No off target data available for this crispr