ID: 985182220

View in Genome Browser
Species Human (GRCh38)
Location 4:187277417-187277439
Sequence TAATATGAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985182220_985182224 8 Left 985182220 4:187277417-187277439 CCAGCCTCCTTCTCCTCATATTA No data
Right 985182224 4:187277448-187277470 TTGAAATCTGTGCTACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985182220 Original CRISPR TAATATGAGGAGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr