ID: 985183805

View in Genome Browser
Species Human (GRCh38)
Location 4:187295074-187295096
Sequence CTCCAGTTGAATCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985183805_985183809 14 Left 985183805 4:187295074-187295096 CCTTGGCCTGGATTCAACTGGAG No data
Right 985183809 4:187295111-187295133 CTGAAACAGCCAGAGACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985183805 Original CRISPR CTCCAGTTGAATCCAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr