ID: 985186922

View in Genome Browser
Species Human (GRCh38)
Location 4:187327562-187327584
Sequence GAGTGTAAACTTAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985186922_985186929 23 Left 985186922 4:187327562-187327584 CCTGTCTCCCTAAGTTTACACTC No data
Right 985186929 4:187327608-187327630 CAACACAACCTTTGCTTTATGGG No data
985186922_985186928 22 Left 985186922 4:187327562-187327584 CCTGTCTCCCTAAGTTTACACTC No data
Right 985186928 4:187327607-187327629 CCAACACAACCTTTGCTTTATGG No data
985186922_985186930 24 Left 985186922 4:187327562-187327584 CCTGTCTCCCTAAGTTTACACTC No data
Right 985186930 4:187327609-187327631 AACACAACCTTTGCTTTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985186922 Original CRISPR GAGTGTAAACTTAGGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr