ID: 985188601

View in Genome Browser
Species Human (GRCh38)
Location 4:187346094-187346116
Sequence GCAGACTGCAGAATAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985188601_985188602 14 Left 985188601 4:187346094-187346116 CCTGTGGTTATTCTGCAGTCTGC No data
Right 985188602 4:187346131-187346153 GTTTGCAGTCTCCATGACATAGG No data
985188601_985188604 18 Left 985188601 4:187346094-187346116 CCTGTGGTTATTCTGCAGTCTGC No data
Right 985188604 4:187346135-187346157 GCAGTCTCCATGACATAGGTGGG No data
985188601_985188605 22 Left 985188601 4:187346094-187346116 CCTGTGGTTATTCTGCAGTCTGC No data
Right 985188605 4:187346139-187346161 TCTCCATGACATAGGTGGGCAGG No data
985188601_985188603 17 Left 985188601 4:187346094-187346116 CCTGTGGTTATTCTGCAGTCTGC No data
Right 985188603 4:187346134-187346156 TGCAGTCTCCATGACATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985188601 Original CRISPR GCAGACTGCAGAATAACCAC AGG (reversed) Intergenic
No off target data available for this crispr