ID: 985189788

View in Genome Browser
Species Human (GRCh38)
Location 4:187360316-187360338
Sequence TTGTATTTGGGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985189781_985189788 23 Left 985189781 4:187360270-187360292 CCATTGCATATAACAGATCTGTT No data
Right 985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985189788 Original CRISPR TTGTATTTGGGGAGGGAAGA AGG Intergenic
No off target data available for this crispr