ID: 985193327

View in Genome Browser
Species Human (GRCh38)
Location 4:187401427-187401449
Sequence GTGAATAAAAGCATGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985193327_985193330 5 Left 985193327 4:187401427-187401449 CCGGTGTCCATGCTTTTATTCAC No data
Right 985193330 4:187401455-187401477 TCTATCTCTTCCTTACTGCAGGG No data
985193327_985193334 28 Left 985193327 4:187401427-187401449 CCGGTGTCCATGCTTTTATTCAC No data
Right 985193334 4:187401478-187401500 CACATATGAAAATGGTGATTGGG No data
985193327_985193329 4 Left 985193327 4:187401427-187401449 CCGGTGTCCATGCTTTTATTCAC No data
Right 985193329 4:187401454-187401476 CTCTATCTCTTCCTTACTGCAGG No data
985193327_985193333 27 Left 985193327 4:187401427-187401449 CCGGTGTCCATGCTTTTATTCAC No data
Right 985193333 4:187401477-187401499 GCACATATGAAAATGGTGATTGG No data
985193327_985193332 20 Left 985193327 4:187401427-187401449 CCGGTGTCCATGCTTTTATTCAC No data
Right 985193332 4:187401470-187401492 CTGCAGGGCACATATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985193327 Original CRISPR GTGAATAAAAGCATGGACAC CGG (reversed) Intergenic
No off target data available for this crispr